VPS35 Rabbit Polyclonal Antibody

VPS35 Rabbit pAb

A7117-100ul 100 ul
EUR 308

VPS35 Rabbit pAb

A7117-200ul 200 ul
EUR 459

VPS35 Rabbit pAb

A7117-20ul 20 ul
EUR 183

VPS35 Rabbit pAb

A7117-50ul 50 ul
EUR 223

Polyclonal VPS35 Antibody (C-Terminus)

AMM08483G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human VPS35 (C-Terminus). This antibody is tested and proven to work in the following applications:

VPS35 Antibody

49784-100ul 100ul
EUR 333

VPS35 Antibody

49784-50ul 50ul
EUR 239

VPS35 Antibody

43824-100ul 100ul
EUR 252

VPS35 Antibody

42841-100ul 100ul
EUR 252

VPS35 antibody

22838-100ul 100ul
EUR 390

VPS35 antibody

70R-13144 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal VPS35 antibody

VPS35 Antibody

DF12793 200ul
EUR 304
Description: VPS35 Antibody detects endogenous levels of VPS35.

VPS35 Antibody

1-CSB-PA839401ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against VPS35. Recognizes VPS35 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

VPS35 Antibody

1-CSB-PA076908
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VPS35. Recognizes VPS35 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

VPS35 Antibody

1-CSB-PA088155
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VPS35. Recognizes VPS35 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

Polyclonal Goat Anti-VPS35 / MEM3 Antibody

APR16425G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-VPS35 / MEM3 . This antibody is tested and proven to work in the following applications:

VPS35 Conjugated Antibody

C42841 100ul
EUR 397

VPS35 Conjugated Antibody

C43824 100ul
EUR 397

VPS35 Conjugated Antibody

C49784 100ul
EUR 397

anti- VPS35 antibody

FNab09439 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IP: 1:200-1:2000
  • IF: 1:10-1:100
  • Immunogen: vacuolar protein sorting 35 homolog(S. cerevisiae)
  • Uniprot ID: Q96QK1
  • Gene ID: 55737
  • Research Area: Neuroscience
Description: Antibody raised against VPS35

Anti-VPS35 antibody

PAab09439 100 ug
EUR 386

Anti-VPS35 antibody

STJ98618 200 µl
EUR 197
Description: Rabbit polyclonal to VPS35.

Anti-VPS35 antibody

STJ29197 100 µl
EUR 277
Description: This gene belongs to a group of vacuolar protein sorting (VPS) genes. The encoded protein is a component of a large multimeric complex, termed the retromer complex, involved in retrograde transport of proteins from endosomes to the trans-Golgi network. The close structural similarity between the yeast and human proteins that make up this complex suggests a similarity in function. Expression studies in yeast and mammalian cells indicate that this protein interacts directly with VPS35, which serves as the core of the retromer complex.

VPS35 siRNA

20-abx939516
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VPS35 siRNA

20-abx939517
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-VPS35

YF-PA26356 50 ul
EUR 334
Description: Mouse polyclonal to VPS35

Anti-VPS35 Monoclonal Antibody

M01644 100ug
EUR 397
Description: Rabbit Monoclonal VPS35 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-VPS35 / MEM3 antibody

STJ70506 100 µg
EUR 359

Monoclonal antibody for VPS35

SMC-602D 0.1mg
EUR 403
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated.

Monoclonal antibody for VPS35

SMC-602D-A390 0.1mg
EUR 450
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 390.

Monoclonal antibody for VPS35

SMC-602D-A488 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 488.

Monoclonal antibody for VPS35

SMC-602D-A565 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 565.

Monoclonal antibody for VPS35

SMC-602D-A594 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 594.

Monoclonal antibody for VPS35

SMC-602D-A633 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 633.

Monoclonal antibody for VPS35

SMC-602D-A655 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 655.

Monoclonal antibody for VPS35

SMC-602D-A680 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 680.

Monoclonal antibody for VPS35

SMC-602D-A700 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 700.

Monoclonal antibody for VPS35

SMC-602D-ALP 0.1mg
EUR 443
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for VPS35

SMC-602D-APC 0.1mg
EUR 448
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC.

Monoclonal antibody for VPS35

SMC-602D-APCCY7 0.1mg
EUR 520
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC/Cy7.

Monoclonal antibody for VPS35

SMC-602D-BI 0.1mg
EUR 445
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Biotin.

Monoclonal antibody for VPS35

SMC-602D-DY350 0.1mg
EUR 463
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 350.

Monoclonal antibody for VPS35

SMC-602D-DY405 0.1mg
EUR 452
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 405.

Monoclonal antibody for VPS35

SMC-602D-DY488 0.1mg
EUR 442
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 488.

Monoclonal antibody for VPS35

SMC-602D-DY594 0.1mg
EUR 444
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 594.

Monoclonal antibody for VPS35

SMC-602D-DY633 0.1mg
EUR 439
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 633.

Monoclonal antibody for VPS35

SMC-602D-FITC 0.1mg
EUR 441
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with FITC.

Monoclonal antibody for VPS35

SMC-602D-HRP 0.1mg
EUR 437
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with HRP.

Monoclonal antibody for VPS35

SMC-602D-P594 0.1mg
EUR 456
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PE/ATTO 594.

Monoclonal antibody for VPS35

SMC-602D-PCP 0.1mg
EUR 448
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PerCP.

Monoclonal antibody for VPS35

SMC-602D-RPE 0.1mg
EUR 446
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with RPE.

Monoclonal antibody for VPS35

SMC-602D-STR 0.1mg
EUR 447
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Streptavidin.

Monoclonal antibody for VPS35

SMC-602S 0.012mg
EUR 65
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated.

Monoclonal antibody for VPS35

SMC-603D 0.1mg
EUR 403
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated.

Monoclonal antibody for VPS35

SMC-603D-A390 0.1mg
EUR 450
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 390.

Monoclonal antibody for VPS35

SMC-603D-A488 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 488.

Monoclonal antibody for VPS35

SMC-603D-A565 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 565.

Monoclonal antibody for VPS35

SMC-603D-A594 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 594.

Monoclonal antibody for VPS35

SMC-603D-A633 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 633.

Monoclonal antibody for VPS35

SMC-603D-A655 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 655.

Monoclonal antibody for VPS35

SMC-603D-A680 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 680.

Monoclonal antibody for VPS35

SMC-603D-A700 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 700.

Monoclonal antibody for VPS35

SMC-603D-ALP 0.1mg
EUR 443
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for VPS35

SMC-603D-APC 0.1mg
EUR 448
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC.

Monoclonal antibody for VPS35

SMC-603D-APCCY7 0.1mg
EUR 520
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC/Cy7.

Monoclonal antibody for VPS35

SMC-603D-BI 0.1mg
EUR 445
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Biotin.

Monoclonal antibody for VPS35

SMC-603D-DY350 0.1mg
EUR 463
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 350.

Monoclonal antibody for VPS35

SMC-603D-DY405 0.1mg
EUR 452
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 405.

Monoclonal antibody for VPS35

SMC-603D-DY488 0.1mg
EUR 442
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 488.

Monoclonal antibody for VPS35

SMC-603D-DY594 0.1mg
EUR 444
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 594.

Monoclonal antibody for VPS35

SMC-603D-DY633 0.1mg
EUR 439
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 633.

Monoclonal antibody for VPS35

SMC-603D-FITC 0.1mg
EUR 441
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with FITC.

Monoclonal antibody for VPS35

SMC-603D-HRP 0.1mg
EUR 437
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with HRP.

Monoclonal antibody for VPS35

SMC-603D-P594 0.1mg
EUR 456
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PE/ATTO 594.

Monoclonal antibody for VPS35

SMC-603D-PCP 0.1mg
EUR 448
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PerCP.

Monoclonal antibody for VPS35

SMC-603D-RPE 0.1mg
EUR 446
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with RPE.

Monoclonal antibody for VPS35

SMC-603D-STR 0.1mg
EUR 447
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Streptavidin.

Monoclonal antibody for VPS35

SMC-603S 0.012mg
EUR 65
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated.

Monoclonal antibody for VPS35

SMC-604D 0.1mg
EUR 403
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated.

Monoclonal antibody for VPS35

SMC-604D-A390 0.1mg
EUR 450
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 390.

Monoclonal antibody for VPS35

SMC-604D-A488 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 488.

Monoclonal antibody for VPS35

SMC-604D-A565 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 565.

Monoclonal antibody for VPS35

SMC-604D-A594 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 594.

Monoclonal antibody for VPS35

SMC-604D-A633 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 633.

Monoclonal antibody for VPS35

SMC-604D-A655 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 655.

Monoclonal antibody for VPS35

SMC-604D-A680 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 680.

Monoclonal antibody for VPS35

SMC-604D-A700 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 700.

Monoclonal antibody for VPS35

SMC-604D-ALP 0.1mg
EUR 443
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for VPS35

SMC-604D-APC 0.1mg
EUR 448
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC.

Monoclonal antibody for VPS35

SMC-604D-APCCY7 0.1mg
EUR 520
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC/Cy7.

Monoclonal antibody for VPS35

SMC-604D-BI 0.1mg
EUR 445
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Biotin.

Monoclonal antibody for VPS35

SMC-604D-DY350 0.1mg
EUR 463
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 350.

Monoclonal antibody for VPS35

SMC-604D-DY405 0.1mg
EUR 452
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 405.

Monoclonal antibody for VPS35

SMC-604D-DY488 0.1mg
EUR 442
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 488.

Monoclonal antibody for VPS35

SMC-604D-DY594 0.1mg
EUR 444
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 594.

Monoclonal antibody for VPS35

SMC-604D-DY633 0.1mg
EUR 439
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 633.

Monoclonal antibody for VPS35

SMC-604D-FITC 0.1mg
EUR 441
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with FITC.

Monoclonal antibody for VPS35

SMC-604D-HRP 0.1mg
EUR 437
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with HRP.

Monoclonal antibody for VPS35

SMC-604D-P594 0.1mg
EUR 456
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PE/ATTO 594.

Monoclonal antibody for VPS35

SMC-604D-PCP 0.1mg
EUR 448
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PerCP.

Monoclonal antibody for VPS35

SMC-604D-RPE 0.1mg
EUR 446
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with RPE.

Monoclonal antibody for VPS35

SMC-604D-STR 0.1mg
EUR 447
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Streptavidin.

Monoclonal antibody for VPS35

SMC-604S 0.012mg
EUR 65
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated.

Monoclonal antibody for VPS35

SMC-605D 0.1mg
EUR 403
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated.

Monoclonal antibody for VPS35

SMC-605D-A390 0.1mg
EUR 450
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 390.

Monoclonal antibody for VPS35

SMC-605D-A488 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 488.

Monoclonal antibody for VPS35

SMC-605D-A565 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 565.

Monoclonal antibody for VPS35

SMC-605D-A594 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 594.

Monoclonal antibody for VPS35

SMC-605D-A633 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 633.

Monoclonal antibody for VPS35

SMC-605D-A655 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 655.

Monoclonal antibody for VPS35

SMC-605D-A680 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 680.

Monoclonal antibody for VPS35

SMC-605D-A700 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 700.

Monoclonal antibody for VPS35

SMC-605D-ALP 0.1mg
EUR 443
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for VPS35

SMC-605D-APC 0.1mg
EUR 448
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC.

Monoclonal antibody for VPS35

SMC-605D-APCCY7 0.1mg
EUR 520
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC/Cy7.

Monoclonal antibody for VPS35

SMC-605D-BI 0.1mg
EUR 445
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Biotin.

Monoclonal antibody for VPS35

SMC-605D-DY350 0.1mg
EUR 463
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 350.

Monoclonal antibody for VPS35

SMC-605D-DY405 0.1mg
EUR 452
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 405.

Monoclonal antibody for VPS35

SMC-605D-DY488 0.1mg
EUR 442
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 488.

Monoclonal antibody for VPS35

SMC-605D-DY594 0.1mg
EUR 444
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 594.

Monoclonal antibody for VPS35

SMC-605D-DY633 0.1mg
EUR 439
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 633.

Monoclonal antibody for VPS35

SMC-605D-FITC 0.1mg
EUR 441
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with FITC.

Monoclonal antibody for VPS35

SMC-605D-HRP 0.1mg
EUR 437
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with HRP.

Monoclonal antibody for VPS35

SMC-605D-P594 0.1mg
EUR 456
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PE/ATTO 594.

Monoclonal antibody for VPS35

SMC-605D-PCP 0.1mg
EUR 448
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PerCP.

Monoclonal antibody for VPS35

SMC-605D-RPE 0.1mg
EUR 446
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with RPE.

Monoclonal antibody for VPS35

SMC-605D-STR 0.1mg
EUR 447
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Streptavidin.

Monoclonal antibody for VPS35

SMC-605S 0.012mg
EUR 65
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated.

Monoclonal antibody for VPS35

SMC-606D 0.1mg
EUR 403
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is not conjugated.

Monoclonal antibody for VPS35

SMC-606D-A390 0.1mg
EUR 450
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 390.

Monoclonal antibody for VPS35

SMC-606D-A488 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 488.

Monoclonal antibody for VPS35

SMC-606D-A565 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 565.

Monoclonal antibody for VPS35

SMC-606D-A594 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 594.

Monoclonal antibody for VPS35

SMC-606D-A633 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 633.

Monoclonal antibody for VPS35

SMC-606D-A655 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 655.

Monoclonal antibody for VPS35

SMC-606D-A680 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 680.

Monoclonal antibody for VPS35

SMC-606D-A700 0.1mg
EUR 449
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 700.

Monoclonal antibody for VPS35

SMC-606D-ALP 0.1mg
EUR 443
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for VPS35

SMC-606D-APC 0.1mg
EUR 448
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with APC.

Monoclonal antibody for VPS35

SMC-606D-APCCY7 0.1mg
EUR 520
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with APC/Cy7.

Monoclonal antibody for VPS35

SMC-606D-BI 0.1mg
EUR 445
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Biotin.

Monoclonal antibody for VPS35

SMC-606D-DY350 0.1mg
EUR 463
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Dylight 350.

Monoclonal antibody for VPS35

SMC-606D-DY405 0.1mg
EUR 452
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Dylight 405.

Monoclonal antibody for VPS35

SMC-606D-DY488 0.1mg
EUR 442
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Dylight 488.

Monoclonal antibody for VPS35

SMC-606D-DY594 0.1mg
EUR 444
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Dylight 594.

Monoclonal antibody for VPS35

SMC-606D-DY633 0.1mg
EUR 439
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Dylight 633.

Monoclonal antibody for VPS35

SMC-606D-FITC 0.1mg
EUR 441
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with FITC.

Monoclonal antibody for VPS35

SMC-606D-HRP 0.1mg
EUR 437
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with HRP.

Monoclonal antibody for VPS35

SMC-606D-P594 0.1mg
EUR 456
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with PE/ATTO 594.

Monoclonal antibody for VPS35

SMC-606D-PCP 0.1mg
EUR 448
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with PerCP.

Monoclonal antibody for VPS35

SMC-606D-RPE 0.1mg
EUR 446
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with RPE.

Monoclonal antibody for VPS35

SMC-606D-STR 0.1mg
EUR 447
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Streptavidin.

Monoclonal antibody for VPS35

SMC-606S 0.012mg
EUR 65
  • Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
  • Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is not conjugated.

VPS35 Blocking Peptide

DF12793-BP 1mg
EUR 195

VPS35 cloning plasmid

CSB-CL839401HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2391
  • Sequence: atgcctacaacacagcagtcccctcaggatgagcaggaaaagctcttggatgaagccatacaggctgtgaaggtccagtcattccaaatgaagagatgcctggacaaaaacaagcttatggatgctctaaaacatgcttctaatatgcttggtgaactccggacttctatgttat
  • Show more
Description: A cloning plasmid for the VPS35 gene.

Anti-VPS35 (2D3)

YF-MA11568 100 ug
EUR 363
Description: Mouse monoclonal to VPS35

Mouse VPS35 shRNA Plasmid

20-abx975334
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

VPS35 ELISA KIT|Human

EF004220 96 Tests
EUR 689

Human VPS35 shRNA Plasmid

20-abx960874
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

VPS35 Recombinant Protein (Human)

RP034396 100 ug Ask for price

VPS35 Recombinant Protein (Rat)

RP237023 100 ug Ask for price

VPS35 Recombinant Protein (Mouse)

RP184916 100 ug Ask for price

Vps35 ORF Vector (Rat) (pORF)

ORF079009 1.0 ug DNA
EUR 506

VPS35 ORF Vector (Human) (pORF)

ORF011466 1.0 ug DNA
EUR 95

Vps35 ORF Vector (Mouse) (pORF)

ORF061640 1.0 ug DNA
EUR 506

Vacuolar Protein Sorting-Associated Protein 35 (VPS35) Antibody

abx122915-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Vacuolar Protein Sorting-Associated Protein 35 (VPS35) Antibody

20-abx006899
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Vacuolar Protein Sorting-Associated Protein 35 (VPS35) Antibody

20-abx320774
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Vacuolar Protein Sorting-Associated Protein 35 (VPS35) Antibody

abx430442-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Vacuolar Protein Sorting-Associated Protein 35 (VPS35) Antibody

abx239439-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Vacuolar protein sorting-associated protein 35 (VPS35) Antibody

20-abx211808
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Vacuolar protein sorting-associated protein 35 (VPS35) Antibody

20-abx212437
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

VPS35 sgRNA CRISPR Lentivector set (Human)

K2618901 3 x 1.0 ug
EUR 339

VPS35 Rabbit Polyclonal Antibody