USP15 Rabbit Polyclonal Antibody

USP15 Polyclonal Antibody

ABP57147-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human USP15 at AA range: 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of USP15 from Human, Mouse, Rat. This USP15 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human USP15 at AA range: 50-130

USP15 Polyclonal Antibody

ABP57147-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human USP15 at AA range: 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of USP15 from Human, Mouse, Rat. This USP15 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human USP15 at AA range: 50-130

USP15 Polyclonal Antibody

ABP57147-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human USP15 at AA range: 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of USP15 from Human, Mouse, Rat. This USP15 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human USP15 at AA range: 50-130

USP15 Rabbit pAb

A6786-100ul 100 ul
EUR 308

USP15 Rabbit pAb

A6786-200ul 200 ul
EUR 459

USP15 Rabbit pAb

A6786-20ul 20 ul
EUR 183

USP15 Rabbit pAb

A6786-50ul 50 ul
EUR 223

USP15 antibody

70R-21195 50 ul
EUR 435
Description: Rabbit polyclonal USP15 antibody

USP15 antibody

70R-9736 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal USP15 antibody

USP15 Antibody

ABD4588 100 ug
EUR 438

USP15 Antibody

35117-100ul 100ul
EUR 252

USP15 Antibody

35117-50ul 50ul
EUR 187

USP15 Antibody

42821-100ul 100ul
EUR 252

USP15 antibody

22855-100ul 100ul
EUR 390

USP15 Antibody

EUR 207

USP15 antibody

70R-12824 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal USP15 antibody

USP15 Antibody

DF4588 200ul
EUR 304
Description: USP15 Antibody detects endogenous levels of total USP15.

USP15 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against USP15. Recognizes USP15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

USP15 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against USP15. Recognizes USP15 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

USP15 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against USP15. Recognizes USP15 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

USP15 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against USP15. Recognizes USP15 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

USP15 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against USP15. Recognizes USP15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

USP15 Antibody

CSB-PA040632-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against USP15. Recognizes USP15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

USP15 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against USP15. Recognizes USP15 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal USP15 Antibody (C-Term)

APG00414G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human USP15 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal USP15 Antibody (C-Terminus)

APG01155G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human USP15 (C-Terminus). This antibody is tested and proven to work in the following applications:

USP15 Conjugated Antibody

C35117 100ul
EUR 397

anti- USP15 antibody

FNab09311 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:500-1:5000
  • IHC: 1:50-1:500
  • Immunogen: ubiquitin specific peptidase 15
  • Uniprot ID: Q9Y4E8
  • Gene ID: 9958
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against USP15

Anti-USP15 antibody

PAab09311 100 ug
EUR 386

Anti-USP15 antibody

STJ70376 100 µg
EUR 359

Anti-USP15 antibody

STJ96195 200 µl
EUR 197
Description: USP15 is a protein encoded by the USP15 gene which is approximately 112,4 kDa. USP15 is localised to the cytoplasm and nucleus. It is involved in pathways such as deubiquitination, metabolism of proteins, mitophagy and NF-kappaB signalling. USP15 falls under the ubiquitin specific protease family of deubiquitinating enzymes. It plays a critical role in ubiquitin-dependent processes through polyubiquitin chain disassembly and hydrolysis of ubiquitin-substrate bonds. It is a hydrolase that removes conjugated ubiquitin from target proteins and regulates various pathways. USP15 is expressed in skeletal muscle, kidney, heart, placenta, liver, thymus, lung, and ovaries. Mutations in the USP15 gene result in speech and communication disorders and isolated microphthalmia. STJ96195 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This polyclonal antibody detects endogenous levels of USP15 protein.

Anti-USP15 antibody

STJ28869 100 µl
EUR 277
Description: This gene encodes a member of the ubiquitin specific protease (USP) family of deubiquitinating enzymes. USP enzymes play critical roles in ubiquitin-dependent processes through polyubiquitin chain disassembly and hydrolysis of ubiquitin-substrate bonds. The encoded protein associates with the COP9 signalosome, and also plays a role in transforming growth factor beta signalling through deubiquitination of receptor-activated SMAD transcription factors. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 2.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

USP15 Blocking Peptide

33R-3459 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of USP15 antibody, catalog no. 70R-9736

USP15 Blocking Peptide

DF4588-BP 1mg
EUR 195

USP15 cloning plasmid

CSB-CL896515HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 708
  • Sequence: atggcggaaggcggagcggcggatctggacacccagcggtctgacatcgcgacgctgctcaaaacctcgctccggaaaggggacacctggtacctagtcgatagtcgctggttcaaacagtggaaaaaatatgttggctttgacagttgggacaaataccagatgggagatcaaaa
  • Show more
Description: A cloning plasmid for the USP15 gene.

USP15 cloning plasmid

CSB-CL896515HU2-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2859
  • Show more
Description: A cloning plasmid for the USP15 gene.

anti-USP15 (1C10)

LF-MA10374 100 ug
EUR 363
Description: Mouse monoclonal to USP15

Rat USP15 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF004119 96 Tests
EUR 689

Human USP15 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

USP15 protein (His tag)

80R-2943 50 ug
EUR 435
Description: Purified recombinant CENPM protein (His tag)

Mouse USP15 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Ubiquitin Specific Peptidase 15 (USP15) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Monoclonal USP15 Antibody (monoclonal) (M01), Clone: 1C10

AMM04295G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human USP15 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1C10. This antibody is applicable in WB and IF

Ubiquitin Carboxyl-Terminal Hydrolase 15 (USP15) Antibody

abx037258-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 15 (USP15) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 15 (USP15) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 15 (USP15) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin carboxyl-terminal hydrolase 15 (USP15) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ubiquitin carboxyl-terminal hydrolase 15 (USP15) Antibody

abx331278-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 15 (USP15) Antibody

abx433431-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 15 (USP15) Antibody

abx239311-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Ubiquitin carboxyl-terminal hydrolase 15 (USP15) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin carboxyl-terminal hydrolase 15 (USP15) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Usp15 ORF Vector (Rat) (pORF)

ORF078683 1.0 ug DNA
EUR 506

USP15 ORF Vector (Human) (pORF)

ORF011362 1.0 ug DNA
EUR 95

USP15 ORF Vector (Human) (pORF)

ORF014899 1.0 ug DNA
EUR 354

Usp15 ORF Vector (Mouse) (pORF)

ORF061114 1.0 ug DNA
EUR 506

USP15 sgRNA CRISPR Lentivector set (Human)

K2598501 3 x 1.0 ug
EUR 339

Usp15 sgRNA CRISPR Lentivector set (Mouse)

K4566101 3 x 1.0 ug
EUR 339

Usp15 sgRNA CRISPR Lentivector set (Rat)

K6941401 3 x 1.0 ug
EUR 339

USP15 sgRNA CRISPR Lentivector (Human) (Target 1)

K2598502 1.0 ug DNA
EUR 154

USP15 sgRNA CRISPR Lentivector (Human) (Target 2)

K2598503 1.0 ug DNA
EUR 154

USP15 sgRNA CRISPR Lentivector (Human) (Target 3)

K2598504 1.0 ug DNA
EUR 154

Usp15 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4566102 1.0 ug DNA
EUR 154

Usp15 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4566103 1.0 ug DNA
EUR 154

Usp15 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4566104 1.0 ug DNA
EUR 154

Usp15 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6941402 1.0 ug DNA
EUR 154

Usp15 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6941403 1.0 ug DNA
EUR 154

Usp15 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6941404 1.0 ug DNA
EUR 154

USP15 Protein Vector (Human) (pPB-C-His)

PV059593 500 ng
EUR 481

USP15 Protein Vector (Human) (pPB-N-His)

PV059594 500 ng
EUR 481

USP15 Protein Vector (Human) (pPM-C-HA)

PV059595 500 ng
EUR 481

USP15 Protein Vector (Human) (pPM-C-His)

PV059596 500 ng
EUR 481

USP15 Protein Vector (Human) (pPB-C-His)

PV045445 500 ng
EUR 329

USP15 Protein Vector (Human) (pPB-N-His)

PV045446 500 ng
EUR 329

USP15 Protein Vector (Human) (pPM-C-HA)

PV045447 500 ng
EUR 329

USP15 Protein Vector (Human) (pPM-C-His)

PV045448 500 ng
EUR 329

Recombinant Human USP15 Protein, His, E.coli-10ug

QP13911-10ug 10ug
EUR 201

Recombinant Human USP15 Protein, His, E.coli-1mg

QP13911-1mg 1mg
EUR 5251

Recombinant Human USP15 Protein, His, E.coli-2ug

QP13911-2ug 2ug
EUR 155

USP15 Protein Vector (Rat) (pPB-C-His)

PV314730 500 ng
EUR 1166

USP15 Protein Vector (Rat) (pPB-N-His)

PV314731 500 ng
EUR 1166

USP15 Protein Vector (Rat) (pPM-C-HA)

PV314732 500 ng
EUR 1166

USP15 Protein Vector (Rat) (pPM-C-His)

PV314733 500 ng
EUR 329

USP15 Protein Vector (Mouse) (pPB-C-His)

PV244454 500 ng
EUR 1065

USP15 Protein Vector (Mouse) (pPB-N-His)

PV244455 500 ng
EUR 1065

USP15 Protein Vector (Mouse) (pPM-C-HA)

PV244456 500 ng
EUR 1065

USP15 Protein Vector (Mouse) (pPM-C-His)

PV244457 500 ng
EUR 1065

Usp15 3'UTR GFP Stable Cell Line

TU171648 1.0 ml Ask for price

USP15 3'UTR GFP Stable Cell Line

TU077974 1.0 ml
EUR 1521

Usp15 3'UTR Luciferase Stable Cell Line

TU121648 1.0 ml Ask for price

USP15 3'UTR Luciferase Stable Cell Line

TU027974 1.0 ml
EUR 1521

Usp15 3'UTR Luciferase Stable Cell Line

TU222923 1.0 ml Ask for price

Usp15 3'UTR GFP Stable Cell Line

TU272923 1.0 ml Ask for price

USP15 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV704235 1.0 ug DNA
EUR 450

USP15 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV704239 1.0 ug DNA
EUR 450

USP15 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV704240 1.0 ug DNA
EUR 450

USP15 Ubiquitin Specific Peptidase 15 Human Recombinant Protein

PROTQ9Y4E8 Regular: 10ug
EUR 317
Description: USP15 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 258 amino acids (1-235) and having a molecular mass of 29.5kDa.

USP15 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV625555 1.0 ug DNA
EUR 1355

USP15 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV625559 1.0 ug DNA
EUR 1355

USP15 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV625560 1.0 ug DNA
EUR 1355

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

USP15 Rabbit Polyclonal Antibody