TRPV4 Rabbit Polyclonal Antibody

TRPV4 Polyclonal Antibody
ABP52771-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human TRPV4
  • Applications tips:
Description: A polyclonal antibody for detection of TRPV4 from Human, Mouse, Rat. This TRPV4 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TRPV4

TRPV4 Polyclonal Antibody
ABP52771-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human TRPV4
  • Applications tips:
Description: A polyclonal antibody for detection of TRPV4 from Human, Mouse, Rat. This TRPV4 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TRPV4

TRPV4 Polyclonal Antibody
ABP52771-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human TRPV4
  • Applications tips:
Description: A polyclonal antibody for detection of TRPV4 from Human, Mouse, Rat. This TRPV4 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TRPV4

TRPV4 Polyclonal Antibody
ABP57558-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic peptide from human protein at AA range: 461-510
  • Applications tips:
Description: A polyclonal antibody for detection of TRPV4 from Human, Mouse, Rat. This TRPV4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 461-510

TRPV4 Polyclonal Antibody
ABP57558-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic peptide from human protein at AA range: 461-510
  • Applications tips:
Description: A polyclonal antibody for detection of TRPV4 from Human, Mouse, Rat. This TRPV4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 461-510

TRPV4 Polyclonal Antibody
ABP57558-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 461-510
  • Applications tips:
Description: A polyclonal antibody for detection of TRPV4 from Human, Mouse, Rat. This TRPV4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 461-510

TRPV4 Rabbit pAb
A5660-100ul 100 ul
EUR 308

TRPV4 Rabbit pAb
A5660-200ul 200 ul
EUR 459

TRPV4 Rabbit pAb
A5660-20ul 20 ul
EUR 183

TRPV4 Rabbit pAb
A5660-50ul 50 ul
EUR 223

Polyclonal TRPV4 Antibody (Internal)
APR13828G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRPV4 (Internal). This antibody is tested and proven to work in the following applications:

TRPV4 antibody
70R-51063 100 ul
EUR 244
Description: Purified Polyclonal TRPV4 antibody

TRPV4 antibody
70R-5164 50 ug
EUR 467
Description: Rabbit polyclonal TRPV4 antibody raised against the middle region of TRPV4

TRPV4 antibody
70R-5169 50 ug
EUR 467
Description: Rabbit polyclonal TRPV4 antibody raised against the middle region of TRPV4

TRPV4 antibody
70R-21016 50 ul
EUR 435
Description: Rabbit polyclonal TRPV4 antibody

TRPV4 Antibody
ABD8624 100 ug
EUR 438

TRPV4 Antibody
32956-100ul 100ul
EUR 252

TRPV4 Antibody
DF8624 200ul
EUR 304
Description: TRPV4 Antibody detects endogenous levels of total TRPV4.

TRPV4 Antibody
1-CSB-PA881015ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TRPV4. Recognizes TRPV4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TRPV4 Antibody
1-CSB-PA004651
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TRPV4. Recognizes TRPV4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

TRPV4 Antibody
1-CSB-PA558953
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRPV4. Recognizes TRPV4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

TRPV4 Antibody
1-CSB-PA160091
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against TRPV4. Recognizes TRPV4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000ELISA:1:10000

TRPV4 Antibody
1-CSB-PA024643
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRPV4. Recognizes TRPV4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

TRPV4 Antibody
1-CSB-PA025096GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TRPV4. Recognizes TRPV4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal TRPV4 Antibody (N-term)
APR13829G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRPV4 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal TRPV4 Antibody (N-Terminus)
APR13830G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRPV4 (N-Terminus). This antibody is tested and proven to work in the following applications:

Anti Mouse TRPV4 Polyclonal Antibody
KM119
EUR 649
Description: The Anti Mouse TRPV4 Polyclonal Antibody is available in Europe and for worldwide shipping via Gentaur.

Trpv4/ Rat Trpv4 ELISA Kit
ELI-29052r 96 Tests
EUR 886

TRPV4 Conjugated Antibody
C32956 100ul
EUR 397

anti- TRPV4 antibody
FNab09028 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: transient receptor potential cation channel, subfamily V, member 4
  • Uniprot ID: Q9HBA0
  • Gene ID: 59341
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against TRPV4

Anti-TRPV4 antibody
PAab09028 100 ug
EUR 386

Anti-TRPV4 Antibody
PA1979 100ug/vial
EUR 294

Anti-TRPV4 antibody
STJ98664 200 µl
EUR 197
Description: Rabbit polyclonal to TRPV4.

Anti-TRPV4 antibody
STJ96405 200 µl
EUR 197
Description: Rabbit polyclonal to TRPV4.

Anti-TRPV4 antibody
STJ27627 100 µl
EUR 277
Description: This gene encodes a member of the OSM9-like transient receptor potential channel (OTRPC) subfamily in the transient receptor potential (TRP) superfamily of ion channels. The encoded protein is a Ca2+-permeable, nonselective cation channel that is thought to be involved in the regulation of systemic osmotic pressure. Mutations in this gene are the cause of spondylometaphyseal and metatropic dysplasia and hereditary motor and sensory neuropathy type IIC. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-TRPV4 antibody
STJ13100253 100 µl
EUR 427

Anti-TRPV4 antibody
STJ13100254 100 µl
EUR 427

Anti-TRPV4 antibody
STJ13100272 100 µl
EUR 427

Anti-TRPV4 antibody
STJ13100412 100 µl
EUR 427

Anti-TRPV4 antibody
STJ13100422 500 µg
EUR 427

TRPV4 siRNA
20-abx905816
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TRPV4 siRNA
20-abx938246
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TRPV4 siRNA
20-abx938247
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TRPV4 Blocking Peptide
20-abx063938
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

TRPV4 Blocking Peptide
33R-8239 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRPV4 antibody, catalog no. 70R-5164

TRPV4 Blocking Peptide
33R-8240 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRPV4 antibody, catalog no. 70R-5169

TRPV4 cloning plasmid
CSB-CL881015HU-10ug 10ug
EUR 842
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2616
  • Sequence: atggcggattccagcgaaggcccccgcgcggggcccggggaggtggctgagctccccggggatgagagtggcaccccaggcggggaggcttttcctctctcctccctggccaatctgtttgagggggaggatggctccctttcgccctcaccggctgatgccagtcgccctgctg
  • Show more
Description: A cloning plasmid for the TRPV4 gene.

TRPV4 Blocking Peptide
DF8624-BP 1mg
EUR 195

Mouse TRPV4 shRNA Plasmid
20-abx975233
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat TRPV4 shRNA Plasmid
20-abx986459
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TRPV4 ELISA KIT|Human
EF003873 96 Tests
EUR 689

Mouse Trpv4 ELISA KIT
ELI-28934m 96 Tests
EUR 865

Human TRPV4 ELISA KIT
ELI-51212h 96 Tests
EUR 824

Human TRPV4 shRNA Plasmid
20-abx961773
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Trpv4 ORF Vector (Rat) (pORF)
ORF078301 1.0 ug DNA
EUR 506

TRPV4 ORF Vector (Human) (pORF)
ORF014839 1.0 ug DNA
EUR 95

Trpv4 ORF Vector (Mouse) (pORF)
ORF060536 1.0 ug DNA
EUR 506

pECMV-Trpv4-m-FLAG Plasmid
PVT15049 2 ug
EUR 325

TRPV4 sgRNA CRISPR Lentivector set (Human)
K2537201 3 x 1.0 ug
EUR 339

Trpv4 sgRNA CRISPR Lentivector set (Rat)
K7550001 3 x 1.0 ug
EUR 339

Trpv4 sgRNA CRISPR Lentivector set (Mouse)
K5033801 3 x 1.0 ug
EUR 339

TRPV4 sgRNA CRISPR Lentivector (Human) (Target 1)
K2537202 1.0 ug DNA
EUR 154

TRPV4 sgRNA CRISPR Lentivector (Human) (Target 2)
K2537203 1.0 ug DNA
EUR 154

TRPV4 sgRNA CRISPR Lentivector (Human) (Target 3)
K2537204 1.0 ug DNA
EUR 154

Trpv4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7550002 1.0 ug DNA
EUR 154

Trpv4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7550003 1.0 ug DNA
EUR 154

Trpv4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7550004 1.0 ug DNA
EUR 154

Trpv4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K5033802 1.0 ug DNA
EUR 154

Trpv4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K5033803 1.0 ug DNA
EUR 154

Trpv4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K5033804 1.0 ug DNA
EUR 154

TRPV4 Protein Vector (Human) (pPB-C-His)
PV059353 500 ng
EUR 481

TRPV4 Rabbit Polyclonal Antibody