TRPV4 Rabbit Polyclonal Antibody

TRPV4 Polyclonal Antibody

ABP57558-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic peptide from human protein at AA range: 461-510
  • Applications tips:
Description: A polyclonal antibody for detection of TRPV4 from Human, Mouse, Rat. This TRPV4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 461-510

TRPV4 Polyclonal Antibody

ABP57558-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 461-510
  • Applications tips:
Description: A polyclonal antibody for detection of TRPV4 from Human, Mouse, Rat. This TRPV4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 461-510

TRPV4 Polyclonal Antibody

ES8551-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TRPV4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TRPV4 Polyclonal Antibody

ES8551-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRPV4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TRPV4 Polyclonal Antibody

ES3770-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TRPV4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TRPV4 Polyclonal Antibody

ES3770-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRPV4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TRPV4 Rabbit pAb

A5660-100ul 100 ul
EUR 308

TRPV4 Rabbit pAb

A5660-200ul 200 ul
EUR 459

TRPV4 Rabbit pAb

A5660-20ul 20 ul
EUR 183

TRPV4 Rabbit pAb

A5660-50ul 50 ul
EUR 223

Polyclonal TRPV4 Antibody (Internal)

APR13828G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRPV4 (Internal). This antibody is tested and proven to work in the following applications:

TRPV4 antibody

70R-21016 50 ul
EUR 435
Description: Rabbit polyclonal TRPV4 antibody

TRPV4 Antibody

32956-100ul 100ul
EUR 252

TRPV4 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TRPV4. Recognizes TRPV4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

TRPV4 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TRPV4. Recognizes TRPV4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TRPV4 Antibody

DF8624 200ul
EUR 304
Description: TRPV4 Antibody detects endogenous levels of total TRPV4.

TRPV4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRPV4. Recognizes TRPV4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

TRPV4 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against TRPV4. Recognizes TRPV4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000ELISA:1:10000

TRPV4 antibody

70R-51063 100 ul
EUR 244
Description: Purified Polyclonal TRPV4 antibody

TRPV4 antibody

70R-5164 50 ug
EUR 467
Description: Rabbit polyclonal TRPV4 antibody raised against the middle region of TRPV4

TRPV4 antibody

70R-5169 50 ug
EUR 467
Description: Rabbit polyclonal TRPV4 antibody raised against the middle region of TRPV4

TRPV4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRPV4. Recognizes TRPV4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

TRPV4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TRPV4. Recognizes TRPV4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TRPV4 Antibody

ABD8624 100 ug
EUR 438

Polyclonal TRPV4 Antibody (N-term)

APR13829G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRPV4 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal TRPV4 Antibody (N-Terminus)

APR13830G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRPV4 (N-Terminus). This antibody is tested and proven to work in the following applications:

Anti Mouse TRPV4 Polyclonal Antibody

EUR 649
Description: The Anti Mouse TRPV4 Polyclonal Antibody is available in Europe and for worldwide shipping via Gentaur.

Trpv4/ Rat Trpv4 ELISA Kit

ELI-29052r 96 Tests
EUR 886

TRPV4 Conjugated Antibody

C32956 100ul
EUR 397

anti- TRPV4 antibody

FNab09028 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: transient receptor potential cation channel, subfamily V, member 4
  • Uniprot ID: Q9HBA0
  • Gene ID: 59341
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against TRPV4

Anti-TRPV4 Antibody

PA1979 100ug/vial
EUR 294

Anti-TRPV4 antibody

PAab09028 100 ug
EUR 386

Anti-TRPV4 antibody

STJ27627 100 µl
EUR 277
Description: This gene encodes a member of the OSM9-like transient receptor potential channel (OTRPC) subfamily in the transient receptor potential (TRP) superfamily of ion channels. The encoded protein is a Ca2+-permeable, nonselective cation channel that is thought to be involved in the regulation of systemic osmotic pressure. Mutations in this gene are the cause of spondylometaphyseal and metatropic dysplasia and hereditary motor and sensory neuropathy type IIC. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-TRPV4 antibody

STJ13100253 100 µl
EUR 427

Anti-TRPV4 antibody

STJ13100254 100 µl
EUR 427

Anti-TRPV4 antibody

STJ13100272 100 µl
EUR 427

Anti-TRPV4 antibody

STJ13100412 100 µl
EUR 427

Anti-TRPV4 antibody

STJ13100422 500 µg
EUR 427

Anti-TRPV4 antibody

STJ96405 200 µl
EUR 197
Description: Rabbit polyclonal to TRPV4.

Anti-TRPV4 antibody

STJ98664 200 µl
EUR 197
Description: Rabbit polyclonal to TRPV4.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TRPV4 Blocking Peptide

33R-8239 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRPV4 antibody, catalog no. 70R-5164

TRPV4 Blocking Peptide

33R-8240 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRPV4 antibody, catalog no. 70R-5169

TRPV4 Blocking Peptide

DF8624-BP 1mg
EUR 195

TRPV4 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

TRPV4 cloning plasmid

CSB-CL881015HU-10ug 10ug
EUR 842
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2616
  • Sequence: atggcggattccagcgaaggcccccgcgcggggcccggggaggtggctgagctccccggggatgagagtggcaccccaggcggggaggcttttcctctctcctccctggccaatctgtttgagggggaggatggctccctttcgccctcaccggctgatgccagtcgccctgctg
  • Show more
Description: A cloning plasmid for the TRPV4 gene.

Mouse Trpv4 ELISA KIT

ELI-28934m 96 Tests
EUR 865


EF003873 96 Tests
EUR 689


ELI-51212h 96 Tests
EUR 824

Mouse TRPV4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat TRPV4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TRPV4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Trpv4 ORF Vector (Rat) (pORF)

ORF078301 1.0 ug DNA
EUR 506

TRPV4 ORF Vector (Human) (pORF)

ORF014839 1.0 ug DNA
EUR 95

Trpv4 ORF Vector (Mouse) (pORF)

ORF060536 1.0 ug DNA
EUR 506

pECMV-Trpv4-m-FLAG Plasmid

PVT15049 2 ug
EUR 325

TRPV4 ELISA Kit (Rat) (OKCA01942)

OKCA01942 96 Wells
EUR 846
Description: Description of target: Non-selective calcium permeant cation channel involved in osmotic sensitivity and mechanosensitivity (PubMed:11081638). Activation by exposure to hypotonicity within the physiological range exhibits an outward rectification (PubMed:11081638). Also activated by heat, low pH, citrate and phorbol esters. Increase of intracellular Ca2+ potentiates currents. Channel activity seems to be regulated by a calmodulin-dependent mechanism with a negative feedback mechanism. Acts as a regulator of intracellular Ca2+ in synoviocytes. Plays an obligatory role as a molecular component in the nonselective cation channel activation induced by 4-alpha-phorbol 12,13-didecanoate and hypotonic stimulation in synoviocytes and also regulates production of IL-8. Together with PKD2, forms mechano- and thermosensitive channels in cilium. Promotes cell-cell junction formation in skin keratinocytes and plays an important role in the formation and/or maintenance of functional intercellular barriers. Negatively regulates expression of PPARGC1A, UCP1, oxidative metabolism and respiration in adipocytes. Regulates expression of chemokines and cytokines related to proinflammatory pathway in adipocytes. Together with AQP5, controls regulatory volume decrease in salivary epithelial cells.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 5.8 pg/mL

Trpv4 sgRNA CRISPR Lentivector set (Mouse)

K5033801 3 x 1.0 ug
EUR 339

Trpv4 sgRNA CRISPR Lentivector set (Rat)

K7550001 3 x 1.0 ug
EUR 339

TRPV4 sgRNA CRISPR Lentivector set (Human)

K2537201 3 x 1.0 ug
EUR 339

Trpv4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K5033802 1.0 ug DNA
EUR 154

Trpv4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K5033803 1.0 ug DNA
EUR 154

Trpv4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K5033804 1.0 ug DNA
EUR 154

Trpv4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7550002 1.0 ug DNA
EUR 154

Trpv4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7550003 1.0 ug DNA
EUR 154

Trpv4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7550004 1.0 ug DNA
EUR 154

TRPV4 sgRNA CRISPR Lentivector (Human) (Target 1)

K2537202 1.0 ug DNA
EUR 154

TRPV4 sgRNA CRISPR Lentivector (Human) (Target 2)

K2537203 1.0 ug DNA
EUR 154

TRPV4 sgRNA CRISPR Lentivector (Human) (Target 3)

K2537204 1.0 ug DNA
EUR 154

TRPV4 Rabbit Polyclonal Antibody