TRIP13 Rabbit Polyclonal Antibody

TRIP13 Polyclonal Antibody

ABP57021-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human TRIP13 at AA range: 360-440
  • Applications tips:
Description: A polyclonal antibody for detection of TRIP13 from Human, Mouse, Rat. This TRIP13 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TRIP13 at AA range: 360-440

TRIP13 Polyclonal Antibody

ABP57021-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human TRIP13 at AA range: 360-440
  • Applications tips:
Description: A polyclonal antibody for detection of TRIP13 from Human, Mouse, Rat. This TRIP13 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TRIP13 at AA range: 360-440

TRIP13 Polyclonal Antibody

ES8020-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TRIP13 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

TRIP13 Polyclonal Antibody

ES8020-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRIP13 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

TRIP13 Rabbit pAb

A3352-100ul 100 ul
EUR 308

TRIP13 Rabbit pAb

A3352-200ul 200 ul
EUR 459

TRIP13 Rabbit pAb

A3352-20ul 20 ul Ask for price

TRIP13 Rabbit pAb

A3352-50ul 50 ul Ask for price

TRIP13 Rabbit pAb

A17357-100ul 100 ul
EUR 308

TRIP13 Rabbit pAb

A17357-200ul 200 ul
EUR 459

TRIP13 Rabbit pAb

A17357-20ul 20 ul
EUR 183

TRIP13 Rabbit pAb

A17357-50ul 50 ul
EUR 223

TRIP13 Polyclonal Conjugated Antibody

C30024 100ul
EUR 397

TRIP13 antibody

70R-21000 50 ul
EUR 435
Description: Rabbit polyclonal TRIP13 antibody

TRIP13 antibody

70R-31912 100 ug
EUR 327
Description: Rabbit polyclonal TRIP13 antibody

TRIP13 antibody

10R-1381 100 ug
EUR 512
Description: Mouse monoclonal TRIP13 antibody

TRIP13 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TRIP13. Recognizes TRIP13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

TRIP13 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIP13. Recognizes TRIP13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

TRIP13 Antibody

DF3293 200ul
EUR 304
Description: TRIP13 Antibody detects endogenous levels of total TRIP13.

TRIP13 antibody

70R-50699 100 ul
EUR 244
Description: Purified Polyclonal TRIP13 antibody

TRIP13 Antibody

AF0570 200ul
EUR 304
Description: TRIP13 Antibody detects endogenous levels of TRIP13.

TRIP13 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TRIP13. Recognizes TRIP13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TRIP13 Antibody

ABD3293 100 ug
EUR 438

TRIP13 Antibody

ABF0570 100 ug
EUR 438

Polyclonal TRIP13 Antibody (C-term)

APR13787G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIP13 (C-term). This antibody is tested and proven to work in the following applications:

TRIP13 Polyclonal Antibody, Biotin Conjugated

A61519 100 µg
EUR 570.55
Description: Ask the seller for details

TRIP13 Polyclonal Antibody, FITC Conjugated

A61520 100 µg
EUR 570.55
Description: The best epigenetics products

TRIP13 Polyclonal Antibody, HRP Conjugated

A61521 100 µg
EUR 570.55
Description: kits suitable for this type of research

anti- TRIP13 antibody

FNab08997 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:200-1:1000
  • IHC: 1:50-1:500
  • Immunogen: thyroid hormone receptor interactor 13
  • Uniprot ID: Q15645
  • Gene ID: 9319
  • Research Area: Signal Transduction
Description: Antibody raised against TRIP13

Anti-TRIP13 antibody

PAab08997 100 ug
EUR 386

Anti-TRIP13 antibody

STJ26240 100 µl
EUR 277
Description: This gene encodes a protein that interacts with thyroid hormone receptors, also known as hormone-dependent transcription factors. The gene product interacts specifically with the ligand binding domain. This gene is one of several that may play a role in early-stage non-small cell lung cancer.

Anti-TRIP13 antibody

STJ119483 100 µl
EUR 277
Description: This gene encodes a protein that interacts with thyroid hormone receptors, also known as hormone-dependent transcription factors. The gene product interacts specifically with the ligand binding domain. This gene is one of several that may play a role in early-stage non-small cell lung cancer.

Anti-TRIP13 antibody

STJ96103 200 µl
EUR 197
Description: Rabbit polyclonal to TRIP13.

Trip13/ Rat Trip13 ELISA Kit

ELI-37800r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TRIP13 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIP13. Recognizes TRIP13 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TRIP13 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIP13. Recognizes TRIP13 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TRIP13 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIP13. Recognizes TRIP13 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TRIP13 Blocking Peptide

DF3293-BP 1mg
EUR 195

TRIP13 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

TRIP13 Blocking Peptide

AF0570-BP 1mg
EUR 195

TRIP13 cloning plasmid

CSB-CL623008HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1299
  • Sequence: atggacgaggccgtgggcgacctgaagcaggcgcttccctgtgtggccgagtcgccaacggtccacgtggaggtgcatcagcgcggcagcagcactgcaaagaaagaagacataaacctgagtgttagaaagctactcaacagacataatattgtgtttggtgattacacatgga
  • Show more
Description: A cloning plasmid for the TRIP13 gene.

TRIP13 Rabbit Polyclonal Antibody