TRAF4 Rabbit Polyclonal Antibody

TRAF4 Polyclonal Antibody
ES8076-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against TRAF4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TRAF4 Rabbit pAb
A7047-100ul	Abclonal	100 ul	EUR 308

TRAF4 Rabbit pAb
A7047-200ul	Abclonal	200 ul	EUR 459

TRAF4 Rabbit pAb
A7047-20ul	Abclonal	20 ul	EUR 183

TRAF4 Rabbit pAb
A7047-50ul	Abclonal	50 ul	EUR 223

Anti-TRAF4 Rabbit Monoclonal Antibody
M03069	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal TRAF4 Antibody. Validated in IF, WB and tested in Human, Mouse.

TRAF4 antibody
70R-10513	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal TRAF4 antibody

TRAF4 antibody
70R-20956	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TRAF4 antibody

TRAF4 Antibody
47224-100ul	SAB	100ul	EUR 252

TRAF4 Antibody
35240-100ul	SAB	100ul	EUR 252

TRAF4 Antibody
35240-50ul	SAB	50ul	EUR 187

TRAF4 Antibody
1-CSB-PA080040	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TRAF4. Recognizes TRAF4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

TRAF4 Antibody
CSB-PA788984-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TRAF4. Recognizes TRAF4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

TRAF4 Antibody
CSB-PA788984-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TRAF4. Recognizes TRAF4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

TRAF4 Antibody
DF4728	Affbiotech	200ul	EUR 304
Description: TRAF4 Antibody detects endogenous levels of total TRAF4.

TRAF4 Antibody
1-CSB-PA024152ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TRAF4. Recognizes TRAF4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TRAF4 Antibody
1-CSB-PA024152GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TRAF4. Recognizes TRAF4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TRAF4 Antibody
ABD4728	Lifescience Market	100 ug	EUR 438

Polyclonal TRAF4 Antibody (C-term)
APR04065G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRAF4 (C-term). This antibody is tested and proven to work in the following applications:

TRAF4 Conjugated Antibody
C35240	SAB	100ul	EUR 397

TRAF4 Conjugated Antibody
C47224	SAB	100ul	EUR 397

anti- TRAF4 antibody
FNab08919	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:200 Immunogen: TNF receptor-associated factor 4 Uniprot ID: Q9BUZ4 Gene ID: 9618 Research Area: Stem Cells, Signal Transduction, Developmental biology
Description: Antibody raised against TRAF4

Anti-TRAF4 Antibody
PA2009	BosterBio	100ug/vial	EUR 334

Anti-TRAF4 antibody
PAab08919	Lifescience Market	100 ug	EUR 386

Anti-TRAF4 antibody
STJ29127	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the TNF receptor associated factor (TRAF) family. TRAF proteins are associated with, and mediate signal transduction from members of the TNF receptor superfamily. The encoded protein has been shown to interact with neurotrophin receptor, p75 (NTR/NTSR1), and negatively regulate NTR induced cell death and NF-kappa B activation. This protein has been found to bind to p47phox, a cytosolic regulatory factor included in a multi-protein complex known as NAD(P)H oxidase. This protein thus, is thought to be involved in the oxidative activation of MAPK8/JNK. Alternatively spliced transcript variants have been observed but the full-length nature of only one has been determined.

Anti-TRAF4 antibody
STJ96084	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to TRAF4.

TRAF4 siRNA
20-abx937913	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TRAF4 siRNA
20-abx937914	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-TRAF4
YF-PA16433	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to TRAF4

anti-TRAF4
YF-PA16434	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to TRAF4

anti-TRAF4
YF-PA16435	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to TRAF4

TRAF4 Blocking Peptide
33R-4877	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRAF4 antibody, catalog no. 70R-10513

TRAF4 Blocking Peptide
DF4728-BP	Affbiotech	1mg	EUR 195

TRAF4 cloning plasmid
CSB-CL024152HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1413 Sequence: atgcctggcttcgactacaagttcctggagaagcccaagcgacggctgctgtgcccactgtgcgggaagcccatgcgcgagcctgtgcaggtttccacctgcggccaccgtttctgcgatacctgcctgcaggagttcctcagtgaaggagtcttcaagtgccctgaggaccagc Show more
Description: A cloning plasmid for the TRAF4 gene.

Anti-TRAF4 (3F6)
YF-MA11191	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TRAF4

TNF Receptor Associated Factor 4 (TRAF4) Polyclonal Antibody (Human)
4-PAG754Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRAF4 (Gln193~Asp444) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 4 (TRAF4)

TRAF4 ELISA KIT|Human
EF003782	Lifescience Market	96 Tests	EUR 689

Mouse TRAF4 shRNA Plasmid
20-abx973208	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human TRAF4 shRNA Plasmid
20-abx956400	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TRAF4 Recombinant Protein (Rat)
RP234506	ABM	100 ug	Ask for price

pLVX-Puro-TRAF4 Plasmid
PVTB00713-4a	Lifescience Market	2 ug	EUR 356

TRAF4 Recombinant Protein (Human)
RP032764	ABM	100 ug	Ask for price

TRAF4 Recombinant Protein (Mouse)
RP180848	ABM	100 ug	Ask for price

TNF Receptor Associated Factor 4 (TRAF4) Polyclonal Antibody (Human), APC
4-PAG754Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRAF4 (Gln193~Asp444) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 4 (TRAF4). This antibody is labeled with APC.

TNF Receptor Associated Factor 4 (TRAF4) Polyclonal Antibody (Human), Biotinylated
4-PAG754Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRAF4 (Gln193~Asp444) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 4 (TRAF4). This antibody is labeled with Biotin.

TNF Receptor Associated Factor 4 (TRAF4) Polyclonal Antibody (Human), Cy3
4-PAG754Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRAF4 (Gln193~Asp444) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 4 (TRAF4). This antibody is labeled with Cy3.

TNF Receptor Associated Factor 4 (TRAF4) Polyclonal Antibody (Human), FITC
4-PAG754Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRAF4 (Gln193~Asp444) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 4 (TRAF4). This antibody is labeled with FITC.

TNF Receptor Associated Factor 4 (TRAF4) Polyclonal Antibody (Human), HRP
4-PAG754Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRAF4 (Gln193~Asp444) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 4 (TRAF4). This antibody is labeled with HRP.

TNF Receptor Associated Factor 4 (TRAF4) Polyclonal Antibody (Human), PE
4-PAG754Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRAF4 (Gln193~Asp444) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 4 (TRAF4). This antibody is labeled with PE.

TNF Receptor Associated Factor 4 (TRAF4) Polyclonal Antibody (Human), APC-Cy7
4-PAG754Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRAF4 (Gln193~Asp444) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 4 (TRAF4). This antibody is labeled with APC-Cy7.

TNF Receptor-Associated Factor 4 (TRAF4) Antibody
20-abx005336	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

TNF Receptor-Associated Factor 4 (TRAF4) Antibody
20-abx015109	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

TNF Receptor Associated Factor 4 (TRAF4) Antibody
20-abx103542	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

TNF Receptor-Associated Factor 4 (TRAF4) Antibody
20-abx116114	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

TNF Receptor-Associated Factor 4 (TRAF4) Antibody
abx145408-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

TNF Receptor-Associated Factor 4 (TRAF4) Antibody
abx028567-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

TNF Receptor-Associated Factor 4 (TRAF4) Antibody
abx028567-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

TNF Receptor-Associated Factor 4 (TRAF4) Antibody
abx238919-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

TNF Receptor-Associated Factor 4 (TRAF4) Antibody
20-abx320771	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

TNF Receptor Associated Factor 4 (TRAF4) Antibody
abx331218-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

TNF Receptor Associated Factor 4 (TRAF4) Antibody
20-abx327309	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Monoclonal TRAF4 Antibody (monoclonal) (M01), Clone: 3F6
AMM04241G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human TRAF4 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3F6. This antibody is applicable in WB and IHC, E

Traf4 ORF Vector (Rat) (pORF)
ORF078170	ABM	1.0 ug DNA	EUR 506

TRAF4 ORF Vector (Human) (pORF)
ORF010922	ABM	1.0 ug DNA	EUR 95

Traf4 ORF Vector (Mouse) (pORF)
ORF060284	ABM	1.0 ug DNA	EUR 506

Traf4 sgRNA CRISPR Lentivector set (Mouse)
K5001001	ABM	3 x 1.0 ug	EUR 339

Traf4 sgRNA CRISPR Lentivector set (Rat)
K6144401	ABM	3 x 1.0 ug	EUR 339

TRAF4 sgRNA CRISPR Lentivector set (Human)
K2433201	ABM	3 x 1.0 ug	EUR 339

Traf4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K5001002	ABM	1.0 ug DNA	EUR 154

Traf4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K5001003	ABM	1.0 ug DNA	EUR 154

Traf4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K5001004	ABM	1.0 ug DNA	EUR 154

Traf4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6144402	ABM	1.0 ug DNA	EUR 154

Traf4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6144403	ABM	1.0 ug DNA	EUR 154

Traf4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6144404	ABM	1.0 ug DNA	EUR 154

TRAF4 sgRNA CRISPR Lentivector (Human) (Target 1)
K2433202	ABM	1.0 ug DNA	EUR 154

TRAF4 sgRNA CRISPR Lentivector (Human) (Target 2)
K2433203	ABM	1.0 ug DNA	EUR 154

TRAF4 sgRNA CRISPR Lentivector (Human) (Target 3)
K2433204	ABM	1.0 ug DNA	EUR 154

TRAF4 Protein Vector (Rat) (pPB-C-His)
PV312678	ABM	500 ng	EUR 603

TRAF4 Protein Vector (Rat) (pPB-N-His)
PV312679	ABM	500 ng	EUR 603

TRAF4 Protein Vector (Rat) (pPM-C-HA)
PV312680	ABM	500 ng	EUR 603

TRAF4 Protein Vector (Rat) (pPM-C-His)
PV312681	ABM	500 ng	EUR 603

TRAF4 Protein Vector (Mouse) (pPB-C-His)
PV241134	ABM	500 ng	EUR 603

TRAF4 Protein Vector (Mouse) (pPB-N-His)
PV241135	ABM	500 ng	EUR 603

TRAF4 Protein Vector (Mouse) (pPM-C-HA)
PV241136	ABM	500 ng	EUR 603

TRAF4 Protein Vector (Mouse) (pPM-C-His)
PV241137	ABM	500 ng	EUR 603

Recombinant TNF Receptor Associated Factor 4 (TRAF4)
4-RPG754Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9BUZ4 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.1kDa Isoelectric Point: 8.5
Description: Recombinant Human TNF Receptor Associated Factor 4 expressed in: E.coli

TRAF4 Protein Vector (Human) (pPB-C-His)
PV043685	ABM	500 ng	EUR 329

TRAF4 Protein Vector (Human) (pPB-N-His)
PV043686	ABM	500 ng	EUR 329

TRAF4 Protein Vector (Human) (pPM-C-HA)
PV043687	ABM	500 ng	EUR 329

TRAF4 Protein Vector (Human) (pPM-C-His)
PV043688	ABM	500 ng	EUR 329

pPLK/GFP+Puro-TRAF4 shRNA-2 Plasmid
PVTB00713-3a	Lifescience Market	2 ug	EUR 356

pPLK/GFP+Puro-TRAF4 shRNA-1 Plasmid
PVTB00713-3b	Lifescience Market	2 ug	EUR 356

Traf4 3'UTR Luciferase Stable Cell Line
TU121023	ABM	1.0 ml	Ask for price

Traf4 3'UTR GFP Stable Cell Line
TU171023	ABM	1.0 ml	Ask for price

Traf4 3'UTR Luciferase Stable Cell Line
TU222376	ABM	1.0 ml	Ask for price

TRAF4 3'UTR GFP Stable Cell Line
TU076212	ABM	1.0 ml	EUR 1394

TRAF4 3'UTR Luciferase Stable Cell Line
TU026212	ABM	1.0 ml	EUR 1394

Traf4 3'UTR GFP Stable Cell Line
TU272376	ABM	1.0 ml	Ask for price

Human TNF Receptor Associated Factor 4 (TRAF4) Protein
20-abx069348	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

TRAF4 Rabbit Polyclonal Antibody