TMPO Rabbit Polyclonal Antibody

TMPO Polyclonal Antibody
ABP57555-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic peptide from human protein at AA range: 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of TMPO from Human, Mouse, Rat. This TMPO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1-50

TMPO Polyclonal Antibody
ABP57555-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic peptide from human protein at AA range: 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of TMPO from Human, Mouse, Rat. This TMPO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1-50

TMPO Polyclonal Antibody
ABP57555-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of TMPO from Human, Mouse, Rat. This TMPO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1-50

TMPO Polyclonal Antibody
46756-100ul 100ul
EUR 252

TMPO Polyclonal Antibody
46756-50ul 50ul
EUR 187

TMPO / TMPO Antibody
20-abx329779
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

TMPO/TMPO Antibody
1-CSB-PA259190
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against TMPO/TMPO. Recognizes TMPO/TMPO from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000

TMPO antibody
70R-20884 50 ul
EUR 435
Description: Rabbit polyclonal TMPO antibody

TMPO Antibody
ABD6994 100 ug
EUR 438

TMPO Antibody
32699-100ul 100ul
EUR 252

TMPO Antibody
DF6994 200ul
EUR 304
Description: TMPO Antibody detects endogenous levels of total TMPO.

TMPO Antibody
1-CSB-PA023913GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TMPO. Recognizes TMPO from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse)
4-PAC824Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO)

[KO Validated] TMPO Rabbit pAb
A2534-100ul 100 ul
EUR 410

[KO Validated] TMPO Rabbit pAb
A2534-200ul 200 ul
EUR 571

[KO Validated] TMPO Rabbit pAb
A2534-20ul 20 ul
EUR 221

[KO Validated] TMPO Rabbit pAb
A2534-50ul 50 ul
EUR 287

TMPO Conjugated Antibody
C32699 100ul
EUR 397

Thymopoietin (TMPO) Antibody
20-abx116091
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody
20-abx131651
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Thymopoietin (TMPO) Antibody
20-abx001974
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody
20-abx142268
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody
abx030767-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody
abx030767-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody
abx028266-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody
abx028266-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody
20-abx174779
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Anti-TMPO antibody
STJ98661 200 µl
EUR 197
Description: TMPO is a protein encoded by the TMPO gene which is approximately 75,4 kDa. TMPO is localised to the nucleus and is involved in the mitotic cell cycle, nuclear envelope reassembly, transport of the SLBP independent mature mRNA and apoptosis. It may be involved in the structural organization of the nucleus and in the post-mitotic nuclear assembly and plays an important role, together with LMNA, in the nuclear anchorage of RB1. It may also be involved in the control of initiation of DNA replication through its interaction with NAKAP95. TMPO is expressed in many tissues and is most abundant in adult thymus and fetal liver. Mutations in the TMPO gene result in dilated cardiomyopathy and dysentery. STJ98661 was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen. This antibody detects endogenous TMPO protein.

Anti-TMPO antibody
STJ25881 100 µl
EUR 413
Description: The protein encoded by this gene resides in the nucleus and may play a role in the assembly of the nuclear lamina, and thus help maintain the structural organization of the nuclear envelope. It may function as a receptor for the attachment of lamin filaments to the inner nuclear membrane. Mutations in this gene are associated with dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.

Polyclonal TMPO / TP / Thymopoietin Antibody (N-Terminus)
APR03096G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMPO / TP / Thymopoietin (N-Terminus). This antibody is tested and proven to work in the following applications:

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), APC
4-PAC824Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with APC.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAC824Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with Biotin.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), Cy3
4-PAC824Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with Cy3.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), FITC
4-PAC824Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with FITC.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), HRP
4-PAC824Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with HRP.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), PE
4-PAC824Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with PE.

TMPO siRNA
20-abx900018
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TMPO siRNA
20-abx900039
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TMPO siRNA
20-abx937501
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TMPO siRNA
20-abx937502
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TMPO siRNA
20-abx937503
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-TMPO
YF-PA27383 50 ug
EUR 363
Description: Mouse polyclonal to TMPO

Anti-TMPO/Lap2 Antibody
A03278 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for TMPO Antibody (TMPO) detection.tested for IHC, WB in Human, Mouse, Rat.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAC824Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with APC-Cy7.

TMPO cloning plasmid
CSB-CL023913HU-10ug 10ug
EUR 492
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1365
  • Sequence: atgccggagttcctggaagacccctcggtcctgacaaaagacaagttgaagagtgagttggtcgccaacaatgtgacgctgccggccggggagcagcgcaaagacgtgtacgtccagctctacctgcagcacctcacggctcgcaaccggccgccgctccccgccggcaccaaca
  • Show more
Description: A cloning plasmid for the TMPO gene.

TMPO Blocking Peptide
DF6994-BP 1mg
EUR 195

Recombinant Thymopoietin (TMPO)
4-RPC824Hu01
  • EUR 445.86
  • EUR 222.00
  • EUR 1396.96
  • EUR 532.32
  • EUR 964.64
  • EUR 361.00
  • EUR 3342.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P42167
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Thymopoietin expressed in: E.coli

Human Thymopoietin (TMPO) Protein
20-abx650199
  • EUR 620.00
  • EUR 272.00
  • EUR 1887.00
  • EUR 746.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat TMPO shRNA Plasmid
20-abx984957
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Tmpo ELISA KIT
ELI-04131m 96 Tests
EUR 865

Human TMPO ELISA KIT
ELI-04132h 96 Tests
EUR 824

Mouse Tmpo ELISA KIT
ELI-04134m 96 Tests
EUR 865

Human TMPO shRNA Plasmid
20-abx954879
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TMPO shRNA Plasmid
20-abx954880
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TMPO shRNA Plasmid
20-abx973144
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TMPO shRNA Plasmid
20-abx973145
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TMPO Recombinant Protein (Human)
RP032329 100 ug Ask for price

TMPO Recombinant Protein (Rat)
RP233936 100 ug Ask for price

TMPO Recombinant Protein (Mouse)
RP180017 100 ug Ask for price

TMPO Recombinant Protein (Mouse)
RP180020 100 ug Ask for price

TMPO Recombinant Protein (Mouse)
RP180023 100 ug Ask for price

TMPO Recombinant Protein (Mouse)
RP180026 100 ug Ask for price

TMPO Recombinant Protein (Mouse)
RP180029 100 ug Ask for price

TMPO Recombinant Protein (Mouse)
RP180032 100 ug Ask for price

Human Thymopoietin (TMPO) ELISA Kit
abx516008-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Thymopoietin (TMPO) ELISA Kit
abx516010-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Thymopoietin (TMPO) ELISA Kit
abx516012-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Thymopoietin(TMPO)ELISA kit
GA-E0838MS-48T 48T
EUR 336

TMPO Rabbit Polyclonal Antibody