TLR8 Rabbit Polyclonal Antibody

Polyclonal TLR8 Antibody
AMM05427G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR8 . This antibody is tested and proven to work in the following applications:

TLR8 Polyclonal Antibody
EA186-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TLR8 from Human/ Rat/ Mouse. This antibody is tested and validated for IHC

TLR8 Polyclonal Antibody
EA186-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TLR8 from Human/ Rat/ Mouse. This antibody is tested and validated for IHC

TLR8 Polyclonal Antibody
ES8215-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TLR8 from Human/Mouse/Rat. This antibody is tested and validated for IHC

TLR8 Polyclonal Antibody
ES8215-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TLR8 from Human/Mouse/Rat. This antibody is tested and validated for IHC

TLR8 Polyclonal Antibody
ABP57216-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR8 from Human, Mouse, Rat. This TLR8 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR8 Polyclonal Antibody
ABP57216-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR8 from Human, Mouse, Rat. This TLR8 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR8 Polyclonal Antibody
ABP57216-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR8 from Human, Mouse, Rat. This TLR8 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR8 Rabbit pAb
A12906-100ul 100 ul
EUR 308

TLR8 Rabbit pAb
A12906-200ul 200 ul
EUR 459

TLR8 Rabbit pAb
A12906-20ul 20 ul
EUR 183

TLR8 Rabbit pAb
A12906-50ul 50 ul
EUR 223

TLR8 Rabbit pAb
A1489-100ul 100 ul
EUR 308

TLR8 Rabbit pAb
A1489-200ul 200 ul
EUR 459

TLR8 Rabbit pAb
A1489-20ul 20 ul
EUR 183

TLR8 Rabbit pAb
A1489-50ul 50 ul
EUR 223

Human Toll Like Receptor 8 (TLR8) ELISA Kit
DLR-TLR8-Hu-48T 48T
EUR 498
  • Should the Human Toll Like Receptor 8 (TLR8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Toll Like Receptor 8 (TLR8) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Toll Like Receptor 8 (TLR8) ELISA Kit
DLR-TLR8-Hu-96T 96T
EUR 647
  • Should the Human Toll Like Receptor 8 (TLR8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Toll Like Receptor 8 (TLR8) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Toll Like Receptor 8 (TLR8) ELISA Kit
RDR-TLR8-Hu-48Tests 48 Tests
EUR 522

Human Toll Like Receptor 8 (TLR8) ELISA Kit
RDR-TLR8-Hu-96Tests 96 Tests
EUR 724

Human Toll Like Receptor 8 (TLR8) ELISA Kit
RD-TLR8-Hu-48Tests 48 Tests
EUR 500

Human Toll Like Receptor 8 (TLR8) ELISA Kit
RD-TLR8-Hu-96Tests 96 Tests
EUR 692

Polyclonal TLR8 Antibody (Internal)
AMM05429G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR8 (Internal). This antibody is tested and proven to work in the following applications:

TLR8 antibody
70R-9660 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TLR8 antibody

TLR8 Antibody
ABD6426 100 ug
EUR 438

TLR8 Antibody
3558R-100
EUR 316

TLR8 Antibody
3558R-30T
EUR 146

TLR8 antibody
10R-6747 100 ul
EUR 705
Description: Mouse monoclonal TLR8 antibody

TLR8 antibody
10R-8042 100 ul
EUR 558
Description: Mouse monoclonal TLR8 antibody

TLR8 Antibody
32289-100ul 100ul
EUR 252

TLR8 Antibody
24229-100ul 100ul
EUR 390

TLR8 Antibody
24232-100ul 100ul
EUR 390

TLR8 Antibody
24233-100ul 100ul
EUR 390

TLR8 antibody
20R-1642 100 ug
EUR 716
Description: Rabbit polyclonal TLR8 antibody

TLR8 antibody
70R-11908 100 ug
EUR 403
Description: Rabbit polyclonal TLR8 antibody

TLR8 antibody
70R-14271 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal TLR8 antibody

TLR8 antibody
70R-14932 200 ug
EUR 543
Description: Affinity purified goat polyclonal TLR8 antibody

TLR8 Antibody
DF6426 200ul
EUR 304
Description: TLR8 Antibody detects endogenous levels of total TLR8.

TLR8 Antibody
1-CSB-PA261777
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR8. Recognizes TLR8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TLR8 Antibody
1-CSB-PA268874
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR8. Recognizes TLR8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

TLR8 Antibody
1-CSB-PA289221
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR8. Recognizes TLR8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

TLR8 Antibody
1-CSB-PA160291
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR8. Recognizes TLR8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TLR8 Antibody
1-CSB-PA080187
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against TLR8. Recognizes TLR8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1:200-500.ELISA:1/10000

TLR8 Antibody
CSB-PA023607KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against TLR8. Recognizes TLR8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

TLR8 Antibody
CSB-PA023607KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against TLR8. Recognizes TLR8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

Polyclonal TLR8 Antibody (N-Terminus)
AMM05430G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR8 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal Mouse TLR8 Antibody (C-term)
APR11141G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse TLR8 (C-term). This antibody is tested and proven to work in the following applications:

TLR8 Conjugated Antibody
C32289 100ul
EUR 397

anti- TLR8 antibody
FNab10155 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: Toll-like receptor 8
  • Uniprot ID: Q9NR97
  • Gene ID: 51311
Description: Antibody raised against TLR8

Mouse TLR8 Antibody
abx028486-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mouse TLR8 Antibody
abx028486-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Anti-TLR8 Antibody
PA1734 100ug/vial
EUR 294

Anti-TLR8 Antibody
RP1073 100ug/vial
EUR 294

Anti-TLR8 antibody
STJ97410 200 µl
EUR 197
Description: Rabbit polyclonal to TLR8.

Anti-TLR8 antibody
STJ25872 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is predominantly expressed in lung and peripheral blood leukocytes, and lies in close proximity to another family member, TLR7, on chromosome X.

Anti-TLR8 antibody
STJ114772 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is predominantly expressed in lung and peripheral blood leukocytes, and lies in close proximity to another family member, TLR7, on chromosome X.

TLR8 siRNA
20-abx936903
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TLR8 siRNA
20-abx936904
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Toll Like Receptor 8 (TLR8) Polyclonal Antibody (Rat)
4-PAB991Ra01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR8 ( His519~Ser812)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 8 (TLR8)

TLR8 cloning plasmid
CSB-CL023607HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3126
  • Sequence: ATGGAAAACATGTTCCTTCAGTCGTCAATGCTGACCTGCATTTTCCTGCTAATATCTGGTTCCTGTGAGTTATGCGCCGAAGAAAATTTTTCTAGAAGCTATCCTTGTGATGAGAAAAAGCAAAATGACTCAGTTATTGCAGAGTGCAGCAATCGTCGACTACAGGAAGTTCCCC
  • Show more
Description: A cloning plasmid for the TLR8 gene.

TLR8 Blocking Peptide
33R-4922 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TLR8 antibody, catalog no. 70R-9660

TLR8 Blocking Peptide
33R-10802 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TLR8 antibody, catalog no. 70R-11908

TLR8 Blocking Peptide
3558RBP-50
EUR 153

TLR8 Blocking Peptide
DF6426-BP 1mg
EUR 195

pcDNA3.1-TLR8 Plasmid
PVTB00528-2c 2 ug
EUR 356

Anti-TLR8 (4B4)
YF-MA18471 100 ug
EUR 363
Description: Mouse monoclonal to TLR8

Anti-TLR8 (1E6)
YF-MA18472 100 ug
EUR 363
Description: Mouse monoclonal to TLR8

Anti-TLR8 (4C1)
YF-MA18473 100 ug
EUR 363
Description: Mouse monoclonal to TLR8

Toll Like Receptor 8 (TLR8) Polyclonal Antibody (Human, Mouse)
4-PAB991Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR8 (Leu844~Lys1039)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Toll Like Receptor 8 (TLR8)

Toll Like Receptor 8 (TLR8) Polyclonal Antibody (Rat), APC
4-PAB991Ra01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR8 ( His519~Ser812)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 8 (TLR8). This antibody is labeled with APC.

Toll Like Receptor 8 (TLR8) Polyclonal Antibody (Rat), Biotinylated
4-PAB991Ra01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR8 ( His519~Ser812)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 8 (TLR8). This antibody is labeled with Biotin.

Toll Like Receptor 8 (TLR8) Polyclonal Antibody (Rat), Cy3
4-PAB991Ra01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR8 ( His519~Ser812)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 8 (TLR8). This antibody is labeled with Cy3.

Toll Like Receptor 8 (TLR8) Polyclonal Antibody (Rat), FITC
4-PAB991Ra01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR8 ( His519~Ser812)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 8 (TLR8). This antibody is labeled with FITC.

Toll Like Receptor 8 (TLR8) Polyclonal Antibody (Rat), HRP
4-PAB991Ra01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR8 ( His519~Ser812)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 8 (TLR8). This antibody is labeled with HRP.

Toll Like Receptor 8 (TLR8) Polyclonal Antibody (Rat), PE
4-PAB991Ra01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR8 ( His519~Ser812)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 8 (TLR8). This antibody is labeled with PE.

Rabbit Toll-like receptor 8(TLR8)ELISA Kit
QY-E30011 96T
EUR 374

Toll Like Receptor 8 (TLR8) Polyclonal Antibody (Human, Mouse), APC
4-PAB991Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR8 (Leu844~Lys1039)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Toll Like Receptor 8 (TLR8). This antibody is labeled with APC.

Toll Like Receptor 8 (TLR8) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAB991Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR8 (Leu844~Lys1039)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Toll Like Receptor 8 (TLR8). This antibody is labeled with Biotin.

Toll Like Receptor 8 (TLR8) Polyclonal Antibody (Human, Mouse), Cy3
4-PAB991Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR8 (Leu844~Lys1039)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Toll Like Receptor 8 (TLR8). This antibody is labeled with Cy3.

Toll Like Receptor 8 (TLR8) Polyclonal Antibody (Human, Mouse), FITC
4-PAB991Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR8 (Leu844~Lys1039)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Toll Like Receptor 8 (TLR8). This antibody is labeled with FITC.

Toll Like Receptor 8 (TLR8) Polyclonal Antibody (Human, Mouse), HRP
4-PAB991Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR8 (Leu844~Lys1039)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Toll Like Receptor 8 (TLR8). This antibody is labeled with HRP.

Toll Like Receptor 8 (TLR8) Polyclonal Antibody (Human, Mouse), PE
4-PAB991Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR8 (Leu844~Lys1039)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Toll Like Receptor 8 (TLR8). This antibody is labeled with PE.

Toll Like Receptor 8 (TLR8) Polyclonal Antibody (Rat), APC-Cy7
4-PAB991Ra01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR8 ( His519~Ser812)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 8 (TLR8). This antibody is labeled with APC-Cy7.

Toll-Like Receptor 8 (TLR8) Antibody
abx117098-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Toll Like Receptor 8 (TLR8) Antibody
20-abx130075
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Toll Like Receptor 8 (TLR8) Antibody
20-abx131785
  • EUR 328.00
  • EUR 815.00
  • EUR 425.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Toll-Like Receptor 8 (TLR8) Antibody
abx122862-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Toll-Like Receptor 8 (TLR8) Antibody
20-abx001263
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Toll Like Receptor 8 (TLR8) Antibody
20-abx102077
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Toll-Like Receptor 8 (TLR8) Antibody
abx027737-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Toll-Like Receptor 8 (TLR8) Antibody
abx027737-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Toll Like Receptor 8 (TLR8) Antibody
20-abx174845
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Toll Like Receptor 8 (TLR8) Antibody
20-abx326825
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Toll Like Receptor 8 (TLR8) Antibody
20-abx339872
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Toll Like Receptor 8 (TLR8) Antibody
20-abx270123
  • EUR 467.00
  • EUR 537.00
  • EUR 272.00
  • EUR 815.00
  • EUR 356.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Toll Like Receptor 8 (TLR8) Antibody
20-abx212688
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Toll Like Receptor 8 (TLR8) Antibody
20-abx212942
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Toll Like Receptor 8 (TLR8) Antibody
20-abx210590
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse TLR8 shRNA Plasmid
20-abx980325
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TLR8 shRNA Plasmid
20-abx959688
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TLR8 (TAntibody (Clone 44B05)
3558-100
EUR 425

pEYFP-N1-TLR8 Plasmid
PVTB00528-2b 2 ug
EUR 356

Toll Like Receptor 8 (TLR8) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAB991Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR8 (Leu844~Lys1039)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Toll Like Receptor 8 (TLR8). This antibody is labeled with APC-Cy7.

Toll Like Receptor 8 (TLR8) Antibody (FITC)
20-abx273659
  • EUR 467.00
  • EUR 244.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Toll Like Receptor 8 (TLR8) Antibody (FITC)
20-abx270421
  • EUR 523.00
  • EUR 606.00
  • EUR 300.00
  • EUR 940.00
  • EUR 384.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Toll Like Receptor 8 (TLR8) Antibody (APC)
20-abx270653
  • EUR 704.00
  • EUR 829.00
  • EUR 370.00
  • EUR 1330.00
  • EUR 495.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Toll Like Receptor 8 (TLR8) Antibody (PE)
20-abx270885
  • EUR 606.00
  • EUR 718.00
  • EUR 328.00
  • EUR 1135.00
  • EUR 439.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Toll Like Receptor 8 (TLR8) Antibody (Biotin)
20-abx272231
  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

h TLR8 inducible lentiviral particles
LVP753 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: h TLR8 (toll-like receptor 8), [alternative names: CD288]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_138636. It also contains a RFP-Blasticidin dual selection marker.

Tlr8 ORF Vector (Mouse) (pORF)
ORF059661 1.0 ug DNA
EUR 506

Tlr8 ORF Vector (Rat) (pORF)
ORF077762 1.0 ug DNA
EUR 506

TLR8 ORF Vector (Human) (pORF)
ORF014730 1.0 ug DNA
EUR 354

pCMV-C-HA-TLR8 Plasmid
PVTB00528-2a 2 ug
EUR 356

TLR8 ELISA Kit (Human) (OKCD02935)
OKCD02935 96 Wells
EUR 792
Description: Description of target: Key component of innate and adaptive immunity. TLRs (Toll-like receptors) control host immune response against pathogens through recognition of molecular patterns specific to microorganisms. Acts via MYD88 and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.108 ng/mL

TLR8 ELISA Kit (Human) (OKEH08461)
OKEH08461 96 Wells
EUR 896
Description: Description of target: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is predominantly expressed in lung and peripheral blood leukocytes, and lies in close proximity to another family member, TLR7, on chromosome X.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078ng/mL

Toll Like Receptor 8 (TLR8) Monoclonal Antibody (Human)
4-MAB991Hu21
  • EUR 247.00
  • EUR 2523.00
  • EUR 628.00
  • EUR 311.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Leu844~Lys1039
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 8 (TLR8)

TLR8 sgRNA CRISPR Lentivector set (Human)
K2380301 3 x 1.0 ug
EUR 339

Tlr8 sgRNA CRISPR Lentivector set (Mouse)
K3878801 3 x 1.0 ug
EUR 339

Human Toll-like receptor 8 (TLR8)
1-CSB-YP023607HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 93.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Toll-like receptor 8(TLR8),partial expressed in Yeast

Tlr8 sgRNA CRISPR Lentivector set (Rat)
K6725801 3 x 1.0 ug
EUR 339

TLR8-AS1 ORF Vector (Human) (pORF)
ORF033955 1.0 ug DNA Ask for price

Recombinant Toll Like Receptor 8 (TLR8)
4-RPB991Hu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9NR97
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.0kDa
  • Isoelectric Point: 6.1
Description: Recombinant Human Toll Like Receptor 8 expressed in: E.coli

Recombinant Toll Like Receptor 8 (TLR8)
4-RPB991Ra01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: A5H300
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 38.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Toll Like Receptor 8 expressed in: E.coli

TranslationBlocker Human TLR8/ CD288 siRNA, 10nmol
QX27-10nmol 10nmol
EUR 377

TranslationBlocker Human TLR8/ CD288 siRNA, 2nmol
QX27-2nmol 2nmol
EUR 276

Monoclonal TLR8 Antibody (aa750-850, clone 44C143), Clone: 44C143
AMM05428G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human TLR8 (aa750-850, clone 44C143). The antibodies are raised in Mouse and are from clone 44C143. This antibody is applicable in WB and IHC-P, Flo

Toll Like Receptor 8 (TLR8) Monoclonal Antibody (Human), APC
4-MAB991Hu21-APC
  • EUR 346.00
  • EUR 3293.00
  • EUR 917.00
  • EUR 441.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Leu844~Lys1039
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 8 (TLR8). This antibody is labeled with APC.

Toll Like Receptor 8 (TLR8) Monoclonal Antibody (Human), Biotinylated
4-MAB991Hu21-Biotin
  • EUR 312.00
  • EUR 2473.00
  • EUR 730.00
  • EUR 382.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Leu844~Lys1039
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 8 (TLR8). This antibody is labeled with Biotin.

Toll Like Receptor 8 (TLR8) Monoclonal Antibody (Human), Cy3
4-MAB991Hu21-Cy3
  • EUR 420.00
  • EUR 4349.00
  • EUR 1181.00
  • EUR 547.00
  • EUR 252.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Leu844~Lys1039
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 8 (TLR8). This antibody is labeled with Cy3.

Toll Like Receptor 8 (TLR8) Monoclonal Antibody (Human), FITC
4-MAB991Hu21-FITC
  • EUR 297.00
  • EUR 2654.00
  • EUR 753.00
  • EUR 373.00
  • EUR 196.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Leu844~Lys1039
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 8 (TLR8). This antibody is labeled with FITC.

Toll Like Receptor 8 (TLR8) Monoclonal Antibody (Human), HRP
4-MAB991Hu21-HRP
  • EUR 316.00
  • EUR 2870.00
  • EUR 811.00
  • EUR 399.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Leu844~Lys1039
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 8 (TLR8). This antibody is labeled with HRP.

Toll Like Receptor 8 (TLR8) Monoclonal Antibody (Human), PE
4-MAB991Hu21-PE
  • EUR 297.00
  • EUR 2654.00
  • EUR 753.00
  • EUR 373.00
  • EUR 196.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Leu844~Lys1039
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 8 (TLR8). This antibody is labeled with PE.

Monoclonal TLR8 (TAntibody (Clone 44B05), Clone: 44B05
AMM05422G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human TLR8 (T (Clone 44B05). The antibodies are raised in Mouse and are from clone 44B05. This antibody is applicable in WB, FC

Human Toll Like Receptor 8 (TLR8) Protein
20-abx069374
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Toll Like Receptor 8 (TLR8) Protein
20-abx167615
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

TLR8 sgRNA CRISPR Lentivector (Human) (Target 1)
K2380302 1.0 ug DNA
EUR 154

TLR8 sgRNA CRISPR Lentivector (Human) (Target 2)
K2380303 1.0 ug DNA
EUR 154

TLR8 sgRNA CRISPR Lentivector (Human) (Target 3)
K2380304 1.0 ug DNA
EUR 154

Tlr8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3878802 1.0 ug DNA
EUR 154

Tlr8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3878803 1.0 ug DNA
EUR 154

Tlr8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3878804 1.0 ug DNA
EUR 154

Tlr8 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6725802 1.0 ug DNA
EUR 154

Tlr8 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6725803 1.0 ug DNA
EUR 154

Tlr8 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6725804 1.0 ug DNA
EUR 154

TLR8 Protein Vector (Human) (pPB-C-His)
PV058917 500 ng
EUR 481

TLR8 Protein Vector (Human) (pPB-N-His)
PV058918 500 ng
EUR 481

TLR8 Protein Vector (Human) (pPM-C-HA)
PV058919 500 ng
EUR 481

TLR8 Protein Vector (Human) (pPM-C-His)
PV058920 500 ng
EUR 481

TLR8 Protein Vector (Rat) (pPB-C-His)
PV311046 500 ng
EUR 1166

TLR8 Protein Vector (Rat) (pPB-N-His)
PV311047 500 ng
EUR 1166

TLR8 Protein Vector (Rat) (pPM-C-HA)
PV311048 500 ng
EUR 1166

TLR8 Protein Vector (Rat) (pPM-C-His)
PV311049 500 ng
EUR 1166

TLR8 Protein Vector (Mouse) (pPB-C-His)
PV238642 500 ng
EUR 1065

TLR8 Protein Vector (Mouse) (pPB-N-His)
PV238643 500 ng
EUR 1065

TLR8 Protein Vector (Mouse) (pPM-C-HA)
PV238644 500 ng
EUR 1065

TLR8 Protein Vector (Mouse) (pPM-C-His)
PV238645 500 ng
EUR 1065

Tlr8 3'UTR GFP Stable Cell Line
TU170552 1.0 ml Ask for price

TLR8 3'UTR GFP Stable Cell Line
TU075646 1.0 ml
EUR 1394

Tlr8 3'UTR Luciferase Stable Cell Line
TU120552 1.0 ml Ask for price

TLR8 3'UTR Luciferase Stable Cell Line
TU025646 1.0 ml
EUR 1394

Tlr8 3'UTR Luciferase Stable Cell Line
TU221944 1.0 ml Ask for price

Tlr8 3'UTR GFP Stable Cell Line
TU271944 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

TLR8 Rabbit Polyclonal Antibody