TLR1 Rabbit Polyclonal Antibody

TLR1 Polyclonal Antibody
EA183-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TLR1 from Human/ Rat/ Mouse. This antibody is tested and validated for IHC

TLR1 Polyclonal Antibody
EA183-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TLR1 from Human/ Rat/ Mouse. This antibody is tested and validated for IHC

TLR1 Polyclonal Antibody
ES8210-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TLR1 from Human/Mouse/Rat. This antibody is tested and validated for IHC

TLR1 Polyclonal Antibody
ES8210-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TLR1 from Human/Mouse/Rat. This antibody is tested and validated for IHC

TLR1 Polyclonal Antibody
ES8212-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TLR1 from Human/Mouse/Rat. This antibody is tested and validated for IHC

TLR1 Polyclonal Antibody
ES8212-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TLR1 from Human/Mouse/Rat. This antibody is tested and validated for IHC

TLR1 Polyclonal Antibody
ABP57211-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR1 from Human, Mouse, Rat. This TLR1 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR1 Polyclonal Antibody
ABP57211-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR1 from Human, Mouse, Rat. This TLR1 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR1 Polyclonal Antibody
ABP57211-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR1 from Human, Mouse, Rat. This TLR1 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR1 Polyclonal Antibody
ABP57213-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR1 from Human, Mouse, Rat. This TLR1 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR1 Polyclonal Antibody
ABP57213-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR1 from Human, Mouse, Rat. This TLR1 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR1 Polyclonal Antibody
ABP57213-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR1 from Human, Mouse, Rat. This TLR1 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR1 Rabbit pAb
A0997-100ul 100 ul
EUR 308

TLR1 Rabbit pAb
A0997-200ul 200 ul
EUR 459

TLR1 Rabbit pAb
A0997-20ul 20 ul
EUR 183

TLR1 Rabbit pAb
A0997-50ul 50 ul
EUR 223

Polyclonal TLR1 Antibody (Internal)
APR02386G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR1 (Internal). This antibody is tested and proven to work in the following applications:

Human Toll Like Receptor 1 (TLR1) ELISA Kit
DLR-TLR1-Hu-48T 48T
EUR 498
  • Should the Human Toll Like Receptor 1 (TLR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Toll Like Receptor 1 (TLR1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Toll Like Receptor 1 (TLR1) ELISA Kit
DLR-TLR1-Hu-96T 96T
EUR 647
  • Should the Human Toll Like Receptor 1 (TLR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Toll Like Receptor 1 (TLR1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit
DLR-TLR1-Mu-48T 48T
EUR 508
  • Should the Mouse Toll Like Receptor 1 (TLR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Toll Like Receptor 1 (TLR1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit
DLR-TLR1-Mu-96T 96T
EUR 661
  • Should the Mouse Toll Like Receptor 1 (TLR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Toll Like Receptor 1 (TLR1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Toll Like Receptor 1 (TLR1) ELISA Kit
RDR-TLR1-Hu-48Tests 48 Tests
EUR 522

Human Toll Like Receptor 1 (TLR1) ELISA Kit
RDR-TLR1-Hu-96Tests 96 Tests
EUR 724

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit
RDR-TLR1-Mu-48Tests 48 Tests
EUR 534

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit
RDR-TLR1-Mu-96Tests 96 Tests
EUR 742

Human Toll Like Receptor 1 (TLR1) ELISA Kit
RD-TLR1-Hu-48Tests 48 Tests
EUR 500

Human Toll Like Receptor 1 (TLR1) ELISA Kit
RD-TLR1-Hu-96Tests 96 Tests
EUR 692

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit
RD-TLR1-Mu-48Tests 48 Tests
EUR 511

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit
RD-TLR1-Mu-96Tests 96 Tests
EUR 709

Polyclonal TLR1 Antibody (N-Terminus)
APR02280G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR1 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal TLR1 Antibody (aa400-450)
APR02824G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR1 (aa400-450). This antibody is tested and proven to work in the following applications:

TLR1 Antibody
ABD6179 100 ug
EUR 438

TLR1 Antibody
3446-100
EUR 338

TLR1 Antibody
32117-100ul 100ul
EUR 252

TLR1 Antibody
24361-100ul 100ul
EUR 390

TLR1 Antibody
24362-100ul 100ul
EUR 390

TLR1 antibody
20R-1578 100 ul
EUR 673
Description: Goat polyclonal TLR1 antibody

TLR1 antibody
70R-11831 100 ul
EUR 447
Description: Goat polyclonal TLR1 antibody

TLR1 Antibody
DF6179 200ul
EUR 304
Description: TLR1 Antibody detects endogenous levels of total TLR1.

TLR1 Antibody
1-CSB-PA953581
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

TLR1 Antibody
1-CSB-PA080182
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1:200-500.ELISA:1/10000

TLR1 Antibody
CSB-PA023599KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

TLR1 Antibody
CSB-PA023599KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

TLR1 Antibody
1-CSB-PA023599LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

TLR1
HY-W011400 500ug
EUR 165

TLR1 Conjugated Antibody
C32117 100ul
EUR 397

Anti-TLR1 Antibody
A00429-2 100ug/vial
EUR 334

Anti-TLR1 Antibody
A00429-3 100ug/vial
EUR 334

Anti-TLR1 Antibody
PA2246 100ug/vial
EUR 294

Anti-TLR1 Antibody
STJ503274 100 µg
EUR 476

Anti-TLR1 Antibody
STJ503276 100 µg
EUR 476

Anti-TLR1 antibody
STJ97405 200 µl
EUR 197
Description: Rabbit polyclonal to TLR1.

Anti-TLR1 antibody
STJ97407 200 µl
EUR 197
Description: Rabbit polyclonal to TLR1.

Anti-TLR1 antibody
STJ25862 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is ubiquitously expressed, and at higher levels than other TLR genes. Different length transcripts presumably resulting from use of alternative polyadenylation site, and/or from alternative splicing, have been noted for this gene.

TLR1 siRNA
20-abx936889
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TLR1 siRNA
20-abx936890
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-TLR1
YF-PA24854 50 ul
EUR 334
Description: Mouse polyclonal to TLR1

TLR1 Antibody, HRP conjugated
1-CSB-PA023599LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TLR1 Antibody, FITC conjugated
1-CSB-PA023599LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TLR1 Antibody, Biotin conjugated
1-CSB-PA023599LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-TLR1 Antibody BIOTIN
STJ503283 100 µg
EUR 586

Anti-TLR1 Antibody FITC
STJ503284 100 µg
EUR 586

Anti-TLR1 Antibody (Biotin)
STJ503285 100 µg
EUR 586

Anti-TLR1 Antibody (FITC)
STJ503286 100 µg
EUR 586

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human)
4-PAB988Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Val114~Val339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1)

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human)
4-PAB988Hu02
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Asp605~Lys785)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1)

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Mouse)
4-PAB988Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Ser25~Ile134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 1 (TLR1)

TLR1 cloning plasmid
CSB-CL023599HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2361
  • Sequence: ATGACTAGCATCTTCCATTTTGCCATTATCTTCATGTTAATACTTCAGATCAGAATACAATTATCTGAAGAAAGTGAATTTTTAGTTGATAGGTCAAAAAACGGTCTCATCCACGTTCCTAAAGACCTATCCCAGAAAACAACAATCTTAAATATATCGCAAAATTATATATCTG
  • Show more
Description: A cloning plasmid for the TLR1 gene.

TLR1 Blocking Peptide
DF6179-BP 1mg
EUR 195

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), APC
4-PAB988Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Val114~Val339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with APC.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), Biotinylated
4-PAB988Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Val114~Val339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with Biotin.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), Cy3
4-PAB988Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Val114~Val339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with Cy3.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), FITC
4-PAB988Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Val114~Val339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with FITC.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), HRP
4-PAB988Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Val114~Val339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with HRP.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), PE
4-PAB988Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Val114~Val339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with PE.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), APC
4-PAB988Hu02-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Asp605~Lys785)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with APC.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), Biotinylated
4-PAB988Hu02-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Asp605~Lys785)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with Biotin.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), Cy3
4-PAB988Hu02-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Asp605~Lys785)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with Cy3.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), FITC
4-PAB988Hu02-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Asp605~Lys785)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with FITC.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), HRP
4-PAB988Hu02-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Asp605~Lys785)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with HRP.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), PE
4-PAB988Hu02-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Asp605~Lys785)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with PE.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Mouse), APC
4-PAB988Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Ser25~Ile134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 1 (TLR1). This antibody is labeled with APC.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Mouse), Biotinylated
4-PAB988Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Ser25~Ile134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 1 (TLR1). This antibody is labeled with Biotin.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Mouse), Cy3
4-PAB988Mu01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Ser25~Ile134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 1 (TLR1). This antibody is labeled with Cy3.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Mouse), FITC
4-PAB988Mu01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Ser25~Ile134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 1 (TLR1). This antibody is labeled with FITC.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Mouse), HRP
4-PAB988Mu01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Ser25~Ile134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 1 (TLR1). This antibody is labeled with HRP.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Mouse), PE
4-PAB988Mu01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Ser25~Ile134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 1 (TLR1). This antibody is labeled with PE.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), APC-Cy7
4-PAB988Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Val114~Val339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with APC-Cy7.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), APC-Cy7
4-PAB988Hu02-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Asp605~Lys785)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with APC-Cy7.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAB988Mu01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Ser25~Ile134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 1 (TLR1). This antibody is labeled with APC-Cy7.

Toll-Like Receptor 1 (TLR1) Antibody
abx117022-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Toll Like Receptor 1 (TLR1) Antibody
20-abx130820
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Toll Like Receptor 1 (TLR1) Antibody
20-abx131782
  • EUR 425.00
  • EUR 1094.00
  • EUR 537.00
  • EUR 154.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Toll-Like Receptor 1 (TLR1) Antibody
20-abx000950
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Toll-Like Receptor 1 (TLR1) Antibody
abx145022-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Toll Like Receptor 1 (TLR1) Antibody
20-abx102056
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Toll Like Receptor 1 (TLR1) Antibody
20-abx102057
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Toll Like Receptor 1 (TLR1) Antibody
20-abx174837
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Toll Like Receptor 1 (TLR1) Antibody
20-abx326826
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Toll-Like Receptor 1 (TLR1) Antibody
20-abx313153
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Toll Like Receptor 1 (TLR1) Antibody
20-abx270116
  • EUR 467.00
  • EUR 537.00
  • EUR 272.00
  • EUR 815.00
  • EUR 356.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Toll Like Receptor 1 (TLR1) Antibody
20-abx178627
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Toll Like Receptor 1 (TLR1) Antibody
20-abx211714
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human TLR1 shRNA Plasmid
20-abx954863
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TLR1 shRNA Plasmid
20-abx973135
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TLR1 Recombinant Protein (Human)
RP044170 100 ug Ask for price

TLR1 Recombinant Protein (Rat)
RP233252 100 ug Ask for price

TLR1 Recombinant Protein (Mouse)
RP178949 100 ug Ask for price

pCMV-Flag-TLR1 Plasmid
PVTB00372-2a 2 ug
EUR 356

pEYFP-N1-TLR1 Plasmid
PVTB00372-2b 2 ug
EUR 356

Toll Like Receptor 1 (TLR1) Antibody (FITC)
20-abx273662
  • EUR 467.00
  • EUR 244.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Toll-Like Receptor 1 (TLR1) Antibody (HRP)
20-abx313154
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Toll-Like Receptor 1 (TLR1) Antibody (FITC)
20-abx313155
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Toll-Like Receptor 1 (TLR1) Antibody (Biotin)
20-abx313156
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Toll Like Receptor 1 (TLR1) Antibody Pair
20-abx370377
  • EUR 1664.00
  • EUR 1066.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Toll Like Receptor 1 (TLR1) Antibody (FITC)
20-abx270414
  • EUR 523.00
  • EUR 606.00
  • EUR 300.00
  • EUR 940.00
  • EUR 384.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Toll Like Receptor 1 (TLR1) Antibody (APC)
20-abx270646
  • EUR 704.00
  • EUR 829.00
  • EUR 370.00
  • EUR 1330.00
  • EUR 495.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Toll Like Receptor 1 (TLR1) Antibody (PE)
20-abx270878
  • EUR 606.00
  • EUR 718.00
  • EUR 328.00
  • EUR 1135.00
  • EUR 439.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Toll Like Receptor 1 (TLR1) Antibody (Biotin)
20-abx272228
  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ELISA kit for Human TLR1
EK5487 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human TLR1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human TLR1 PicoKine ELISA Kit
EK1129 96 wells
EUR 425
Description: For quantitative detection of human TLR1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

CD281/TLR1 ELISA KIT|Human
EF007394 96 Tests
EUR 689

Human Toll-like receptor (TLR1)
1-CSB-YP023599HU
  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 65.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Toll-like receptor(TLR1),partial expressed in Yeast

h TLR1 inducible lentiviral particles
LVP743 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: h TLR1 (toll-like receptor 1), [alternative names: CD281; rsc786; TIL; TIL. LPRS5]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_003263. It also contains a RFP-Blasticidin dual selection marker.

Tlr1 ORF Vector (Mouse) (pORF)
ORF059651 1.0 ug DNA
EUR 506

Tlr1 ORF Vector (Rat) (pORF)
ORF077752 1.0 ug DNA
EUR 506

TLR1 ORF Vector (Human) (pORF)
ORF014724 1.0 ug DNA
EUR 354

pECMV-Tlr1-m-FLAG Plasmid
PVT15247 2 ug
EUR 325

TLR1 ELISA Kit (Human) (OKAN05048)
OKAN05048 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is ubiquitously expressed, and at higher levels than other TLR genes. Different length transcripts presumably resulting from use of alternative polyadenylation site, and/or from alternative splicing, have been noted for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.114 ng/mL

TLR1 ELISA Kit (Human) (OKBB00505)
OKBB00505 96 Wells
EUR 505
Description: Description of target: TLR1 is a member of the Toll-like receptor family (TLR) of pattern recognition receptors of the innate immune system. TIR1 gene was mapped to 4p14 by fluorescence in situ hybridization. TLR1 recognizes pathogen-associated molecular pattern with a specificity for gram-positive bacteria. TLR1 has also been designated as CD281 (cluster of differentiation 281). TLR1 interacts with TLR2 to recognize the lipid configuration of the native mycobacterial lipoprotein as well as several triacylated lipopeptides.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

TLR1 ELISA Kit (Human) (OKCD07880)
OKCD07880 96 Wells
EUR 936
Description: Description of target: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is ubiquitously expressed, and at higher levels than other TLR genes. Different length transcripts presumably resulting from use of alternative polyadenylation site, and/or from alternative splicing, have been noted for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.127ng/mL

TLR1 ELISA Kit (Mouse) (OKCD07881)
OKCD07881 96 Wells
EUR 818
Description: Description of target: Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.108ng/mL

Anti-Human TLR1 DyLight® 488 conjugated Antibody
A00429-Dyl488 100ug/vial
EUR 344

Anti-Human TLR1 DyLight® 550 conjugated Antibody
A00429-Dyl550 100ug/vial
EUR 344

Toll Like Receptor 1 (TLR1) Monoclonal Antibody (Human)
4-MAB988Hu21
  • EUR 310.00
  • EUR 3500.00
  • EUR 850.00
  • EUR 400.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val114~Val339
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 1 (TLR1)

TLR1 sgRNA CRISPR Lentivector set (Human)
K2379701 3 x 1.0 ug
EUR 339

Tlr1 sgRNA CRISPR Lentivector set (Mouse)
K4373201 3 x 1.0 ug
EUR 339

Tlr1 sgRNA CRISPR Lentivector set (Rat)
K6213301 3 x 1.0 ug
EUR 339

Recombinant Toll Like Receptor 1 (TLR1)
4-RPB988Hu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15399
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Toll Like Receptor 1 expressed in: E.coli

Recombinant Toll Like Receptor 1 (TLR1)
4-RPB988Hu02
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15399
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Toll Like Receptor 1 expressed in: E.coli

Recombinant Toll Like Receptor 1 (TLR1)
4-RPB988Mu01
  • EUR 386.72
  • EUR 206.00
  • EUR 1175.20
  • EUR 458.40
  • EUR 816.80
  • EUR 322.00
  • EUR 2788.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9EPQ1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 42.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Toll Like Receptor 1 expressed in: E.coli

Toll Like Receptor 1 (TLR1) Monoclonal Antibody (Human), APC
4-MAB988Hu21-APC
  • EUR 440.00
  • EUR 4625.00
  • EUR 1250.00
  • EUR 575.00
  • EUR 260.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val114~Val339
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with APC.

Toll Like Receptor 1 (TLR1) Monoclonal Antibody (Human), Biotinylated
4-MAB988Hu21-Biotin
  • EUR 381.00
  • EUR 3450.00
  • EUR 975.00
  • EUR 480.00
  • EUR 249.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val114~Val339
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with Biotin.

Toll Like Receptor 1 (TLR1) Monoclonal Antibody (Human), Cy3
4-MAB988Hu21-Cy3
  • EUR 545.00
  • EUR 6125.00
  • EUR 1625.00
  • EUR 725.00
  • EUR 305.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val114~Val339
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with Cy3.

Toll Like Receptor 1 (TLR1) Monoclonal Antibody (Human), FITC
4-MAB988Hu21-FITC
  • EUR 372.00
  • EUR 3720.00
  • EUR 1020.00
  • EUR 480.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val114~Val339
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with FITC.

Toll Like Receptor 1 (TLR1) Monoclonal Antibody (Human), HRP
4-MAB988Hu21-HRP
  • EUR 398.00
  • EUR 4025.00
  • EUR 1100.00
  • EUR 515.00
  • EUR 242.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val114~Val339
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with HRP.

Toll Like Receptor 1 (TLR1) Monoclonal Antibody (Human), PE
4-MAB988Hu21-PE
  • EUR 372.00
  • EUR 3720.00
  • EUR 1020.00
  • EUR 480.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val114~Val339
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with PE.

Human Toll Like Receptor 1 (TLR1) Protein
20-abx069356
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Toll Like Receptor 1 (TLR1) Protein
20-abx069357
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Toll Like Receptor 1 (TLR1) Protein
20-abx168804
  • EUR 551.00
  • EUR 244.00
  • EUR 1595.00
  • EUR 648.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

TLR1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2379702 1.0 ug DNA
EUR 154

TLR1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2379703 1.0 ug DNA
EUR 154

TLR1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2379704 1.0 ug DNA
EUR 154

Tlr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4373202 1.0 ug DNA
EUR 154

Tlr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4373203 1.0 ug DNA
EUR 154

Tlr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4373204 1.0 ug DNA
EUR 154

Tlr1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6213302 1.0 ug DNA
EUR 154

Tlr1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6213303 1.0 ug DNA
EUR 154

Tlr1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6213304 1.0 ug DNA
EUR 154

TLR1 Protein Vector (Human) (pPB-C-His)
PV058893 500 ng
EUR 481

TLR1 Protein Vector (Human) (pPB-N-His)
PV058894 500 ng
EUR 481

TLR1 Protein Vector (Human) (pPM-C-HA)
PV058895 500 ng
EUR 481

TLR1 Protein Vector (Human) (pPM-C-His)
PV058896 500 ng
EUR 481

TLR1 Protein Vector (Rat) (pPB-C-His)
PV311006 500 ng
EUR 1166

TLR1 Protein Vector (Rat) (pPB-N-His)
PV311007 500 ng
EUR 1166

TLR1 Protein Vector (Rat) (pPM-C-HA)
PV311008 500 ng
EUR 1166

TLR1 Protein Vector (Rat) (pPM-C-His)
PV311009 500 ng
EUR 1166

TLR1 Protein Vector (Mouse) (pPB-C-His)
PV238602 500 ng
EUR 1065

TLR1 Protein Vector (Mouse) (pPB-N-His)
PV238603 500 ng
EUR 1065

TLR1 Protein Vector (Mouse) (pPM-C-HA)
PV238604 500 ng
EUR 1065

TLR1 Protein Vector (Mouse) (pPM-C-His)
PV238605 500 ng
EUR 1065

Tlr1 3'UTR GFP Stable Cell Line
TU170542 1.0 ml Ask for price

TLR1 3'UTR GFP Stable Cell Line
TU075639 1.0 ml
EUR 1394

Tlr1 3'UTR Luciferase Stable Cell Line
TU120542 1.0 ml Ask for price

TLR1 3'UTR Luciferase Stable Cell Line
TU025639 1.0 ml
EUR 1394

Tlr1 3'UTR Luciferase Stable Cell Line
TU221934 1.0 ml Ask for price

Tlr1 3'UTR GFP Stable Cell Line
TU271934 1.0 ml Ask for price

TLR1 ELISA Kit (Mouse) : 96 Wells (OKEH01414)
OKEH01414 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.079 ng/mL

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

TLR1 Rabbit Polyclonal Antibody