TLR1 Rabbit Polyclonal Antibody

Polyclonal TLR1 Antibody
APR06374G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR1 . This antibody is tested and proven to work in the following applications:

Polyclonal TLR1 Antibody
APR06375G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR1 . This antibody is tested and proven to work in the following applications:

TLR1 Polyclonal Antibody
ABP57211-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR1 from Human, Mouse, Rat. This TLR1 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR1 Polyclonal Antibody
ABP57211-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR1 from Human, Mouse, Rat. This TLR1 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR1 Polyclonal Antibody
ABP57211-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR1 from Human, Mouse, Rat. This TLR1 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR1 Polyclonal Antibody
ABP57213-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR1 from Human, Mouse, Rat. This TLR1 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR1 Polyclonal Antibody
ABP57213-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR1 from Human, Mouse, Rat. This TLR1 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR1 Polyclonal Antibody
ABP57213-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR1 from Human, Mouse, Rat. This TLR1 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TLR1 Polyclonal Antibody
ES8210-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TLR1 from Human/Mouse/Rat. This antibody is tested and validated for IHC

TLR1 Polyclonal Antibody
ES8210-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TLR1 from Human/Mouse/Rat. This antibody is tested and validated for IHC

TLR1 Polyclonal Antibody
ES8212-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TLR1 from Human/Mouse/Rat. This antibody is tested and validated for IHC

TLR1 Polyclonal Antibody
ES8212-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TLR1 from Human/Mouse/Rat. This antibody is tested and validated for IHC

TLR1 Rabbit pAb
A0997-100ul 100 ul
EUR 308

TLR1 Rabbit pAb
A0997-200ul 200 ul
EUR 459

TLR1 Rabbit pAb
A0997-20ul 20 ul
EUR 183

TLR1 Rabbit pAb
A0997-50ul 50 ul
EUR 223

Polyclonal TLR1 Antibody (Internal)
APR02386G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR1 (Internal). This antibody is tested and proven to work in the following applications:

Human Toll Like Receptor 1 (TLR1) ELISA Kit
DLR-TLR1-Hu-48T 48T
EUR 498
  • Should the Human Toll Like Receptor 1 (TLR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Toll Like Receptor 1 (TLR1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Toll Like Receptor 1 (TLR1) ELISA Kit
DLR-TLR1-Hu-96T 96T
EUR 647
  • Should the Human Toll Like Receptor 1 (TLR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Toll Like Receptor 1 (TLR1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit
DLR-TLR1-Mu-48T 48T
EUR 508
  • Should the Mouse Toll Like Receptor 1 (TLR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Toll Like Receptor 1 (TLR1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit
DLR-TLR1-Mu-96T 96T
EUR 661
  • Should the Mouse Toll Like Receptor 1 (TLR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Toll Like Receptor 1 (TLR1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Toll Like Receptor 1 (TLR1) ELISA Kit
RDR-TLR1-Hu-48Tests 48 Tests
EUR 522

Human Toll Like Receptor 1 (TLR1) ELISA Kit
RDR-TLR1-Hu-96Tests 96 Tests
EUR 724

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit
RDR-TLR1-Mu-48Tests 48 Tests
EUR 534

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit
RDR-TLR1-Mu-96Tests 96 Tests
EUR 742

Human Toll Like Receptor 1 (TLR1) ELISA Kit
RD-TLR1-Hu-48Tests 48 Tests
EUR 500

Human Toll Like Receptor 1 (TLR1) ELISA Kit
RD-TLR1-Hu-96Tests 96 Tests
EUR 692

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit
RD-TLR1-Mu-48Tests 48 Tests
EUR 511

Mouse Toll Like Receptor 1 (TLR1) ELISA Kit
RD-TLR1-Mu-96Tests 96 Tests
EUR 709

Polyclonal TLR1 Antibody (N-Terminus)
APR02280G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR1 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal TLR1 Antibody (aa400-450)
APR02824G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR1 (aa400-450). This antibody is tested and proven to work in the following applications:

TLR1 Antibody
24361-100ul 100ul
EUR 390

TLR1 Antibody
24362-100ul 100ul
EUR 390

TLR1 antibody
20R-1578 100 ul
EUR 673
Description: Goat polyclonal TLR1 antibody

TLR1 antibody
70R-11831 100 ul
EUR 447
Description: Goat polyclonal TLR1 antibody

TLR1 Antibody
3446-100
EUR 338

TLR1 Antibody
32117-100ul 100ul
EUR 252

TLR1 Antibody
1-CSB-PA080182
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1:200-500.ELISA:1/10000

TLR1 Antibody
1-CSB-PA953581
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

TLR1 Antibody
DF6179 200ul
EUR 304
Description: TLR1 Antibody detects endogenous levels of total TLR1.

TLR1 Antibody
CSB-PA023599KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

TLR1 Antibody
CSB-PA023599KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

TLR1 Antibody
1-CSB-PA023599LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

TLR1 Antibody
ABD6179 100 ug
EUR 438

TLR1
HY-W011400 500ug
EUR 165

Anti-TLR1 Antibody
A00429-2 100ug/vial
EUR 334

Anti-TLR1 Antibody
A00429-3 100ug/vial
EUR 334

TLR1 Conjugated Antibody
C32117 100ul
EUR 397

Anti-TLR1 Antibody
PA2246 100ug/vial
EUR 294

Anti-TLR1 antibody
STJ25862 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is ubiquitously expressed, and at higher levels than other TLR genes. Different length transcripts presumably resulting from use of alternative polyadenylation site, and/or from alternative splicing, have been noted for this gene.

Anti-TLR1 antibody
STJ97405 200 µl
EUR 197
Description: Rabbit polyclonal to TLR1.

Anti-TLR1 antibody
STJ97407 200 µl
EUR 197
Description: Rabbit polyclonal to TLR1.

Anti-TLR1 Antibody
STJ503274 100 µg
EUR 476

Anti-TLR1 Antibody
STJ503276 100 µg
EUR 476

TLR1 siRNA
20-abx936889
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TLR1 siRNA
20-abx936890
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-TLR1
YF-PA24854 50 ul
EUR 334
Description: Mouse polyclonal to TLR1

TLR1 Antibody, HRP conjugated
1-CSB-PA023599LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TLR1 Antibody, FITC conjugated
1-CSB-PA023599LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TLR1 Antibody, Biotin conjugated
1-CSB-PA023599LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR1. Recognizes TLR1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-TLR1 Antibody BIOTIN
STJ503283 100 µg
EUR 586

Anti-TLR1 Antibody FITC
STJ503284 100 µg
EUR 586

Anti-TLR1 Antibody (Biotin)
STJ503285 100 µg
EUR 586

Anti-TLR1 Antibody (FITC)
STJ503286 100 µg
EUR 586

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human)
4-PAB988Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Val114~Val339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1)

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human)
4-PAB988Hu02
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Asp605~Lys785)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1)

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Mouse)
4-PAB988Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Ser25~Ile134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 1 (TLR1)

TLR1 Blocking Peptide
DF6179-BP 1mg
EUR 195

TLR1 cloning plasmid
CSB-CL023599HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2361
  • Sequence: ATGACTAGCATCTTCCATTTTGCCATTATCTTCATGTTAATACTTCAGATCAGAATACAATTATCTGAAGAAAGTGAATTTTTAGTTGATAGGTCAAAAAACGGTCTCATCCACGTTCCTAAAGACCTATCCCAGAAAACAACAATCTTAAATATATCGCAAAATTATATATCTG
  • Show more
Description: A cloning plasmid for the TLR1 gene.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), APC
4-PAB988Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Val114~Val339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with APC.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), Biotinylated
4-PAB988Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Val114~Val339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with Biotin.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), Cy3
4-PAB988Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Val114~Val339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with Cy3.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), FITC
4-PAB988Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Val114~Val339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with FITC.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), HRP
4-PAB988Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Val114~Val339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with HRP.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), PE
4-PAB988Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Val114~Val339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with PE.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), APC
4-PAB988Hu02-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Asp605~Lys785)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with APC.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), Biotinylated
4-PAB988Hu02-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Asp605~Lys785)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with Biotin.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), Cy3
4-PAB988Hu02-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Asp605~Lys785)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with Cy3.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), FITC
4-PAB988Hu02-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Asp605~Lys785)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with FITC.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), HRP
4-PAB988Hu02-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Asp605~Lys785)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with HRP.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), PE
4-PAB988Hu02-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Asp605~Lys785)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with PE.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Mouse), APC
4-PAB988Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Ser25~Ile134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 1 (TLR1). This antibody is labeled with APC.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Mouse), Biotinylated
4-PAB988Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Ser25~Ile134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 1 (TLR1). This antibody is labeled with Biotin.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Mouse), Cy3
4-PAB988Mu01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Ser25~Ile134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 1 (TLR1). This antibody is labeled with Cy3.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Mouse), FITC
4-PAB988Mu01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Ser25~Ile134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 1 (TLR1). This antibody is labeled with FITC.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Mouse), HRP
4-PAB988Mu01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Ser25~Ile134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 1 (TLR1). This antibody is labeled with HRP.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Mouse), PE
4-PAB988Mu01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Ser25~Ile134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 1 (TLR1). This antibody is labeled with PE.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), APC-Cy7
4-PAB988Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Val114~Val339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with APC-Cy7.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Human), APC-Cy7
4-PAB988Hu02-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Asp605~Lys785)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with APC-Cy7.

Toll Like Receptor 1 (TLR1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAB988Mu01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR1 (Ser25~Ile134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 1 (TLR1). This antibody is labeled with APC-Cy7.

Toll Like Receptor 1 (TLR1) Antibody
20-abx178627
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Toll Like Receptor 1 (TLR1) Antibody
20-abx211714
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Toll Like Receptor 1 (TLR1) Antibody
20-abx102056
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Toll Like Receptor 1 (TLR1) Antibody
20-abx102057
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Toll-Like Receptor 1 (TLR1) Antibody
abx117022-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Toll Like Receptor 1 (TLR1) Antibody
20-abx130820
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Toll Like Receptor 1 (TLR1) Antibody
20-abx131782
  • EUR 425.00
  • EUR 1094.00
  • EUR 537.00
  • EUR 154.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Toll-Like Receptor 1 (TLR1) Antibody
abx145022-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Toll Like Receptor 1 (TLR1) Antibody
20-abx174837
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Toll Like Receptor 1 (TLR1) Antibody
20-abx270116
  • EUR 467.00
  • EUR 537.00
  • EUR 272.00
  • EUR 815.00
  • EUR 356.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Toll Like Receptor 1 (TLR1) Antibody
20-abx326826
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Toll-Like Receptor 1 (TLR1) Antibody
20-abx313153
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Toll-Like Receptor 1 (TLR1) Antibody
20-abx000950
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse TLR1 shRNA Plasmid
20-abx973135
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TLR1 shRNA Plasmid
20-abx954863
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TLR1 Recombinant Protein (Rat)
RP233252 100 ug Ask for price

pCMV-Flag-TLR1 Plasmid
PVTB00372-2a 2 ug
EUR 356

pEYFP-N1-TLR1 Plasmid
PVTB00372-2b 2 ug
EUR 356

TLR1 Recombinant Protein (Human)
RP044170 100 ug Ask for price

TLR1 Recombinant Protein (Mouse)
RP178949 100 ug Ask for price

Toll Like Receptor 1 (TLR1) Antibody (FITC)
20-abx270414
  • EUR 523.00
  • EUR 606.00
  • EUR 300.00
  • EUR 940.00
  • EUR 384.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Toll Like Receptor 1 (TLR1) Antibody (APC)
20-abx270646
  • EUR 704.00
  • EUR 829.00
  • EUR 370.00
  • EUR 1330.00
  • EUR 495.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Toll Like Receptor 1 (TLR1) Antibody (PE)
20-abx270878
  • EUR 606.00
  • EUR 718.00
  • EUR 328.00
  • EUR 1135.00
  • EUR 439.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Toll Like Receptor 1 (TLR1) Antibody (Biotin)
20-abx272228
  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Toll Like Receptor 1 (TLR1) Antibody Pair
20-abx370377
  • EUR 1664.00
  • EUR 1066.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Toll Like Receptor 1 (TLR1) Antibody (FITC)
20-abx273662
  • EUR 467.00
  • EUR 244.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Toll-Like Receptor 1 (TLR1) Antibody (HRP)
20-abx313154
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Toll-Like Receptor 1 (TLR1) Antibody (FITC)
20-abx313155
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Toll-Like Receptor 1 (TLR1) Antibody (Biotin)
20-abx313156
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Toll-like receptor (TLR1)
1-CSB-YP023599HU
  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 65.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Toll-like receptor(TLR1),partial expressed in Yeast

ELISA kit for Human TLR1
EK5487 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human TLR1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human TLR1 PicoKine ELISA Kit
EK1129 96 wells
EUR 425
Description: For quantitative detection of human TLR1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

CD281/TLR1 ELISA KIT|Human
EF007394 96 Tests
EUR 689

Tlr1 ORF Vector (Rat) (pORF)
ORF077752 1.0 ug DNA
EUR 506

h TLR1 inducible lentiviral particles
LVP743 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: h TLR1 (toll-like receptor 1), [alternative names: CD281; rsc786; TIL; TIL. LPRS5]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_003263. It also contains a RFP-Blasticidin dual selection marker.

TLR1 ORF Vector (Human) (pORF)
ORF014724 1.0 ug DNA
EUR 354

Tlr1 ORF Vector (Mouse) (pORF)
ORF059651 1.0 ug DNA
EUR 506

pECMV-Tlr1-m-FLAG Plasmid
PVT15247 2 ug
EUR 325

Anti-Human TLR1 DyLight® 488 conjugated Antibody
A00429-Dyl488 100ug/vial
EUR 344

Anti-Human TLR1 DyLight® 550 conjugated Antibody
A00429-Dyl550 100ug/vial
EUR 344

Toll Like Receptor 1 (TLR1) Monoclonal Antibody (Human)
4-MAB988Hu21
  • EUR 310.00
  • EUR 3500.00
  • EUR 850.00
  • EUR 400.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val114~Val339
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 1 (TLR1)

Tlr1 sgRNA CRISPR Lentivector set (Rat)
K6213301 3 x 1.0 ug
EUR 339

Tlr1 sgRNA CRISPR Lentivector set (Mouse)
K4373201 3 x 1.0 ug
EUR 339

TLR1 sgRNA CRISPR Lentivector set (Human)
K2379701 3 x 1.0 ug
EUR 339

Recombinant Toll Like Receptor 1 (TLR1)
4-RPB988Hu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15399
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Toll Like Receptor 1 expressed in: E.coli

Recombinant Toll Like Receptor 1 (TLR1)
4-RPB988Hu02
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15399
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Toll Like Receptor 1 expressed in: E.coli

Recombinant Toll Like Receptor 1 (TLR1)
4-RPB988Mu01
  • EUR 386.72
  • EUR 206.00
  • EUR 1175.20
  • EUR 458.40
  • EUR 816.80
  • EUR 322.00
  • EUR 2788.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9EPQ1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 42.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Toll Like Receptor 1 expressed in: E.coli

Toll Like Receptor 1 (TLR1) Monoclonal Antibody (Human), APC
4-MAB988Hu21-APC
  • EUR 440.00
  • EUR 4625.00
  • EUR 1250.00
  • EUR 575.00
  • EUR 260.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val114~Val339
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with APC.

Toll Like Receptor 1 (TLR1) Monoclonal Antibody (Human), Biotinylated
4-MAB988Hu21-Biotin
  • EUR 381.00
  • EUR 3450.00
  • EUR 975.00
  • EUR 480.00
  • EUR 249.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val114~Val339
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with Biotin.

Toll Like Receptor 1 (TLR1) Monoclonal Antibody (Human), Cy3
4-MAB988Hu21-Cy3
  • EUR 545.00
  • EUR 6125.00
  • EUR 1625.00
  • EUR 725.00
  • EUR 305.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val114~Val339
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with Cy3.

Toll Like Receptor 1 (TLR1) Monoclonal Antibody (Human), FITC
4-MAB988Hu21-FITC
  • EUR 372.00
  • EUR 3720.00
  • EUR 1020.00
  • EUR 480.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val114~Val339
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with FITC.

Toll Like Receptor 1 (TLR1) Monoclonal Antibody (Human), HRP
4-MAB988Hu21-HRP
  • EUR 398.00
  • EUR 4025.00
  • EUR 1100.00
  • EUR 515.00
  • EUR 242.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val114~Val339
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with HRP.

Toll Like Receptor 1 (TLR1) Monoclonal Antibody (Human), PE
4-MAB988Hu21-PE
  • EUR 372.00
  • EUR 3720.00
  • EUR 1020.00
  • EUR 480.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val114~Val339
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Toll Like Receptor 1 (TLR1). This antibody is labeled with PE.

Mouse Toll Like Receptor 1 (TLR1) Protein
20-abx168804
  • EUR 551.00
  • EUR 244.00
  • EUR 1595.00
  • EUR 648.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Toll Like Receptor 1 (TLR1) Protein
20-abx069356
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Toll Like Receptor 1 (TLR1) Protein
20-abx069357
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Tlr1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6213302 1.0 ug DNA
EUR 154

Tlr1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6213303 1.0 ug DNA
EUR 154

Tlr1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6213304 1.0 ug DNA
EUR 154

Tlr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4373202 1.0 ug DNA
EUR 154

Tlr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4373203 1.0 ug DNA
EUR 154

Tlr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4373204 1.0 ug DNA
EUR 154

TLR1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2379702 1.0 ug DNA
EUR 154

TLR1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2379703 1.0 ug DNA
EUR 154

TLR1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2379704 1.0 ug DNA
EUR 154

TLR1 Protein Vector (Rat) (pPB-C-His)
PV311006 500 ng
EUR 1166

TLR1 Protein Vector (Rat) (pPB-N-His)
PV311007 500 ng
EUR 1166

TLR1 Protein Vector (Rat) (pPM-C-HA)
PV311008 500 ng
EUR 1166

TLR1 Protein Vector (Rat) (pPM-C-His)
PV311009 500 ng
EUR 1166

TLR1 Protein Vector (Human) (pPB-C-His)
PV058893 500 ng
EUR 481

TLR1 Protein Vector (Human) (pPB-N-His)
PV058894 500 ng
EUR 481

TLR1 Protein Vector (Human) (pPM-C-HA)
PV058895 500 ng
EUR 481

TLR1 Protein Vector (Human) (pPM-C-His)
PV058896 500 ng
EUR 481

TLR1 Protein Vector (Mouse) (pPB-C-His)
PV238602 500 ng
EUR 1065

TLR1 Protein Vector (Mouse) (pPB-N-His)
PV238603 500 ng
EUR 1065

TLR1 Protein Vector (Mouse) (pPM-C-HA)
PV238604 500 ng
EUR 1065

TLR1 Protein Vector (Mouse) (pPM-C-His)
PV238605 500 ng
EUR 1065

Tlr1 3'UTR Luciferase Stable Cell Line
TU120542 1.0 ml Ask for price

Tlr1 3'UTR GFP Stable Cell Line
TU170542 1.0 ml Ask for price

Tlr1 3'UTR Luciferase Stable Cell Line
TU221934 1.0 ml Ask for price

TLR1 3'UTR GFP Stable Cell Line
TU075639 1.0 ml
EUR 1394

Tlr1 3'UTR GFP Stable Cell Line
TU271934 1.0 ml Ask for price

TLR1 3'UTR Luciferase Stable Cell Line
TU025639 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

TLR1 Rabbit Polyclonal Antibody