SSTR2 Rabbit Polyclonal Antibody

SSTR2 Polyclonal Antibody

ABP57449-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human SSTR2
  • Applications tips:
Description: A polyclonal antibody for detection of SSTR2 from Human, Mouse, Rat. This SSTR2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human SSTR2

SSTR2 Polyclonal Antibody

ES8442-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SSTR2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SSTR2 Polyclonal Antibody

ES8442-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SSTR2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SSTR2 Rabbit pAb

A3135-100ul 100 ul
EUR 308

SSTR2 Rabbit pAb

A3135-200ul 200 ul
EUR 459

SSTR2 Rabbit pAb

A3135-20ul 20 ul
EUR 183

SSTR2 Rabbit pAb

A3135-50ul 50 ul
EUR 223

SSTR2 Rabbit pAb

A15101-100ul 100 ul
EUR 308

SSTR2 Rabbit pAb

A15101-200ul 200 ul
EUR 459

SSTR2 Rabbit pAb

A15101-20ul 20 ul
EUR 183

SSTR2 Rabbit pAb

A15101-50ul 50 ul
EUR 223

SSTR2 antibody

70R-14231 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal SSTR2 antibody

SSTR2 Antibody

37257-100ul 100ul
EUR 252

SSTR2 antibody

38600-100ul 100ul
EUR 252

SSTR2 Antibody

1-CSB-PA617002
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SSTR2. Recognizes SSTR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

SSTR2 Antibody

DF7206 200ul
EUR 304
Description: SSTR2 Antibody detects endogenous levels of total SSTR2.

SSTR2 Antibody

1-CSB-PA260413
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SSTR2. Recognizes SSTR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200

SSTR2 antibody

70R-9813 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SSTR2 antibody

SSTR2 antibody

70R-51336 100 ul
EUR 244
Description: Purified Polyclonal SSTR2 antibody

SSTR2 Antibody

1-CSB-PA022725LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SSTR2. Recognizes SSTR2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

SSTR2 Antibody

ABD7206 100 ug
EUR 438

Polyclonal SSTR2 Antibody (C-Terminus)

APR10246G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SSTR2 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal SSTR2 Antibody (Cytoplasmic Domain)

APR10247G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SSTR2 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal SSTR2 Antibody (Extracellular Domain)

APR10248G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SSTR2 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

Polyclonal SSTR2 antibody - middle region

APR10250G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SSTR2 - middle region. This antibody is tested and proven to work in the following applications:

Polyclonal SSTR2 Antibody - C-terminal region

APR10249G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SSTR2 - C-terminal region. This antibody is tested and proven to work in the following applications:

SSTR2 Conjugated Antibody

C37257 100ul
EUR 397

SSTR2 Conjugated Antibody

C38600 100ul
EUR 397

anti- SSTR2 antibody

FNab08253 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:100
  • Immunogen: somatostatin receptor 2
  • Uniprot ID: P30874
  • Gene ID: 6752
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against SSTR2

Anti-SSTR2 antibody

PAab08253 100 ug
EUR 412

Anti-SSTR2 antibody

STJ25706 100 µl
EUR 277
Description: Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR2 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in cerebrum and kidney.

Anti-SSTR2 antibody

STJ117295 100 µl
EUR 277
Description: Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR2 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in cerebrum and kidney.

Anti-SSTR2 antibody

STJ97705 200 µl
EUR 197
Description: Rabbit polyclonal to SSTR2.

SSTR2 siRNA

20-abx905297
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SSTR2 siRNA

20-abx935278
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SSTR2 siRNA

20-abx935279
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SSTR2 Antibody, HRP conjugated

1-CSB-PA022725LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SSTR2. Recognizes SSTR2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SSTR2 Antibody, FITC conjugated

1-CSB-PA022725LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SSTR2. Recognizes SSTR2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SSTR2 Antibody, Biotin conjugated

1-CSB-PA022725LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SSTR2. Recognizes SSTR2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SSTR2 Blocking Peptide

33R-8247 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SSTR2 antibody, catalog no. 70R-9813

SSTR2 Blocking Peptide

DF7206-BP 1mg
EUR 195

SSTR2 Blocking Peptide

20-abx064211
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

SSTR2 cloning plasmid

CSB-CL022725HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1110
  • Sequence: atggacatggcggatgagccactcaatggaagccacacatggctatccattccatttgacctcaatggctctgtggtgtcaaccaacacctcaaaccagacagagccgtactatgacctgacaagcaatgcagtcctcacattcatctattttgtggtctgcatcattgggttgt
  • Show more
Description: A cloning plasmid for the SSTR2 gene.

Somatostatin Receptor 2 (SSTR2) Antibody

20-abx214697
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Somatostatin Receptor 2 (SSTR2) Antibody

20-abx214723
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Somatostatin Receptor Type 2 (SSTR2) Antibody

20-abx007819
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Somatostatin Receptor Type 2 (SSTR2) Antibody

abx238253-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Somatostatin Receptor Type 2 (SSTR2) Antibody

20-abx317864
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Somatostatin Receptor Type 2 (SSTR2) Antibody

20-abx002252
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-Somatostatin Receptor 2/SSTR2 Antibody

PA1694 100ug/vial
EUR 294

Human SSTR2 ELISA Kit

ELA-E2292h 96 Tests
EUR 824

SSTR2 ELISA KIT|Human

EF006273 96 Tests
EUR 689

Mouse SSTR2 shRNA Plasmid

20-abx972787
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SSTR2 shRNA Plasmid

20-abx985832
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SSTR2 shRNA Plasmid

20-abx954615
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Somatostatin Receptor-2-SSTR2

MO15109 100 ug
EUR 409

Somatostatin Receptor-2-SSTR2

RA25005 100 ul
EUR 383

SSTr2 Recombinant Protein (Rat)

RP231206 100 ug Ask for price

pCMV-SPORT6-SSTR2 Plasmid

PVT16171 2 ug
EUR 325

SSTr2 Recombinant Protein (Human)

RP030184 100 ug Ask for price

SSTr2 Recombinant Protein (Mouse)

RP175664 100 ug Ask for price

SSTr2 Recombinant Protein (Mouse)

RP175667 100 ug Ask for price

Somatostatin Receptor Type 2 (SSTR2) Antibody (HRP)

20-abx313112
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Somatostatin Receptor Type 2 (SSTR2) Antibody (FITC)

20-abx313113
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Somatostatin Receptor Type 2 (SSTR2) Antibody (Biotin)

20-abx313114
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sstr2 ORF Vector (Rat) (pORF)

ORF077070 1.0 ug DNA
EUR 506

SSTR2 ORF Vector (Human) (pORF)

ORF010062 1.0 ug DNA
EUR 95

Sstr2 ORF Vector (Mouse) (pORF)

ORF058556 1.0 ug DNA
EUR 506

Sstr2 ORF Vector (Mouse) (pORF)

ORF058557 1.0 ug DNA
EUR 506

Recombinant Somatostatin Receptor 2 (SSTR2)

4-RPG032Hu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Somatostatin Receptor 2 expressed in: E.coli

Human Somatostatin Receptor 2 (SSTR2) Protein

20-abx652236
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Sstr2 sgRNA CRISPR Lentivector set (Rat)

K6874201 3 x 1.0 ug
EUR 339

Sstr2 sgRNA CRISPR Lentivector set (Mouse)

K3395601 3 x 1.0 ug
EUR 339

SSTR2 sgRNA CRISPR Lentivector set (Human)

K2291101 3 x 1.0 ug
EUR 339

Human Somatostatin Receptor 2 (SSTR2) ELISA Kit

abx352051-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Sstr2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6874202 1.0 ug DNA
EUR 154

Sstr2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6874203 1.0 ug DNA
EUR 154

Sstr2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6874204 1.0 ug DNA
EUR 154

Sstr2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3395602 1.0 ug DNA
EUR 154

Sstr2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3395603 1.0 ug DNA
EUR 154

Sstr2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3395604 1.0 ug DNA
EUR 154

SSTR2 sgRNA CRISPR Lentivector (Human) (Target 1)

K2291102 1.0 ug DNA
EUR 154

SSTR2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2291103 1.0 ug DNA
EUR 154

SSTR2 sgRNA CRISPR Lentivector (Human) (Target 3)

K2291104 1.0 ug DNA
EUR 154

SSTr2 Protein Vector (Rat) (pPB-C-His)

PV308278 500 ng
EUR 603

SSTr2 Protein Vector (Rat) (pPB-N-His)

PV308279 500 ng
EUR 603

SSTr2 Protein Vector (Rat) (pPM-C-HA)

PV308280 500 ng
EUR 603

SSTr2 Protein Vector (Rat) (pPM-C-His)

PV308281 500 ng
EUR 603

SSTr2 Protein Vector (Human) (pPB-C-His)

PV040245 500 ng
EUR 329

SSTr2 Protein Vector (Human) (pPB-N-His)

PV040246 500 ng
EUR 329

SSTr2 Protein Vector (Human) (pPM-C-HA)

PV040247 500 ng
EUR 329

SSTr2 Protein Vector (Human) (pPM-C-His)

PV040248 500 ng
EUR 329

SSTr2 Protein Vector (Mouse) (pPB-C-His)

PV234222 500 ng
EUR 603

SSTr2 Protein Vector (Mouse) (pPB-N-His)

PV234223 500 ng
EUR 603

SSTr2 Protein Vector (Mouse) (pPM-C-HA)

PV234224 500 ng
EUR 603

SSTr2 Protein Vector (Mouse) (pPM-C-His)

PV234225 500 ng
EUR 603

SSTr2 Protein Vector (Mouse) (pPB-C-His)

PV234226 500 ng
EUR 603

SSTr2 Protein Vector (Mouse) (pPB-N-His)

PV234227 500 ng
EUR 603

SSTr2 Protein Vector (Mouse) (pPM-C-HA)

PV234228 500 ng
EUR 603

SSTr2 Protein Vector (Mouse) (pPM-C-His)

PV234229 500 ng
EUR 603

Human Somatostatin Receptor 2(SSTR2)ELISA Kit

QY-E01574 96T
EUR 361

Sstr2 3'UTR Luciferase Stable Cell Line

TU119747 1.0 ml Ask for price

Sstr2 3'UTR GFP Stable Cell Line

TU169747 1.0 ml Ask for price

Sstr2 3'UTR Luciferase Stable Cell Line

TU221228 1.0 ml Ask for price

SSTR2 3'UTR GFP Stable Cell Line

TU074672 1.0 ml
EUR 1394

Sstr2 3'UTR GFP Stable Cell Line

TU271228 1.0 ml Ask for price

SSTR2 3'UTR Luciferase Stable Cell Line

TU024672 1.0 ml
EUR 1394

ELISA kit for Human SSTR2 (Somatostatin Receptor 2)

E-EL-H2197 1 plate of 96 wells
EUR 534
  • Gentaur's SSTR2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SSTR2. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human SSTR2 (Somatostatin Receptor 2) in samples from Serum, Plasma, Cell supernatant

Human Somatostatin receptor type 2 (SSTR2) ELISA Kit

abx251546-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human SSTR2(Somatostatin receptor type 2) ELISA Kit

EH2204 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: P30874
  • Alias: SSTR2/Smstr2/SST2/SSTR2/somatostatin receptor 2/somatostatin receptor type 2/SRIF-1/SS2R/SS-2-R/SS2-R/SRIF-1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

SSTR2 Rabbit Polyclonal Antibody