SPOP Rabbit Polyclonal Antibody

SPOP Polyclonal Antibody

ABP57529-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from SPOP at AA range: 41-90
  • Applications tips:
Description: A polyclonal antibody for detection of SPOP from Human, Mouse, Rat. This SPOP antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from SPOP at AA range: 41-90

SPOP Polyclonal Antibody

ABP57529-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from SPOP at AA range: 41-90
  • Applications tips:
Description: A polyclonal antibody for detection of SPOP from Human, Mouse, Rat. This SPOP antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from SPOP at AA range: 41-90

SPOP Polyclonal Antibody

ES8522-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SPOP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

SPOP Polyclonal Antibody

ES8522-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SPOP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

SPOP Rabbit pAb

A12106-100ul 100 ul
EUR 308

SPOP Rabbit pAb

A12106-200ul 200 ul
EUR 459

SPOP Rabbit pAb

A12106-20ul 20 ul
EUR 183

SPOP Rabbit pAb

A12106-50ul 50 ul
EUR 223

SPOP Rabbit pAb

A7621-100ul 100 ul
EUR 308

SPOP Rabbit pAb

A7621-200ul 200 ul
EUR 459

SPOP Rabbit pAb

A7621-20ul 20 ul
EUR 183

SPOP Rabbit pAb

A7621-50ul 50 ul
EUR 223

SPOP Polyclonal Conjugated Antibody

C46746 100ul
EUR 397

SPOP Antibody

DF12106 200ul
EUR 304
Description: SPOP antibody detects endogenous levels of SPOP.

SPOP antibody

70R-8876 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SPOP antibody

SPOP Antibody

1-CSB-PA022601LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPOP. Recognizes SPOP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Rabbit SPOP ELISA Kit

ERTS0183 96Tests
EUR 521

SPOP Polyclonal Antibody, Biotin Conjugated

A61131 100 µg
EUR 570.55
Description: The best epigenetics products

SPOP Polyclonal Antibody, FITC Conjugated

A61132 100 µg
EUR 570.55
Description: kits suitable for this type of research

SPOP Polyclonal Antibody, HRP Conjugated

A61133 100 µg
EUR 570.55
Description: fast delivery possible

Anti-SPOP Antibody

A02032 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for SPOP Antibody (SPOP) detection.tested for IHC, WB in Human, Mouse, Rat.

anti- SPOP antibody

FNab08189 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:500
  • IP : 1:500-1:1000
  • Immunogen: speckle-type POZ protein
  • Uniprot ID: O43791
  • Gene ID: 8405
  • Research Area: Metabolism
Description: Antibody raised against SPOP

Anti-SPOP antibody

PAab08189 100 ug
EUR 386

Anti-SPOP antibody

STJ114000 100 µl
EUR 277
Description: This gene encodes a protein that may modulate the transcriptional repression activities of death-associated protein 6 (DAXX), which interacts with histone deacetylase, core histones, and other histone-associated proteins. In mouse, the encoded protein binds to the putative leucine zipper domain of macroH2A1.2, a variant H2A histone that is enriched on inactivated X chromosomes. The BTB/POZ domain of this protein has been shown in other proteins to mediate transcriptional repression and to interact with components of histone deacetylase co-repressor complexes. Alternative splicing of this gene results in multiple transcript variants encoding the same protein.

Anti-SPOP antibody

STJ29758 100 µl
EUR 277
Description: This gene encodes a protein that may modulate the transcriptional repression activities of death-associated protein 6 (DAXX), which interacts with histone deacetylase, core histones, and other histone-associated proteins. In mouse, the encoded protein binds to the putative leucine zipper domain of macroH2A1.2, a variant H2A histone that is enriched on inactivated X chromosomes. The BTB/POZ domain of this protein has been shown in other proteins to mediate transcriptional repression and to interact with components of histone deacetylase co-repressor complexes. Alternative splicing of this gene results in multiple transcript variants encoding the same protein.

Anti-SPOP antibody

STJ98635 200 µl
EUR 197
Description: Rabbit polyclonal to SPOP.

SPOP siRNA

20-abx935022
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SPOP siRNA

20-abx935023
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-SPOP

YF-PA15616 50 ug
EUR 363
Description: Mouse polyclonal to SPOP

anti-SPOP

YF-PA15617 100 ug
EUR 403
Description: Rabbit polyclonal to SPOP

SPOP Antibody, HRP conjugated

1-CSB-PA022601LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPOP. Recognizes SPOP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SPOP Antibody, FITC conjugated

1-CSB-PA022601LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPOP. Recognizes SPOP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SPOP Antibody, Biotin conjugated

1-CSB-PA022601LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPOP. Recognizes SPOP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SPOP Blocking Peptide

33R-10118 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SPOP antibody, catalog no. 70R-8876

SPOP Blocking Peptide

DF12106-BP 1mg
EUR 195

SPOP cloning plasmid

CSB-CL022601HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1125
  • Sequence: atgtcaagggttccaagtcctccacctccggcagaaatgtcgagtggccccgtagctgagagttggtgctacacacagatcaaggtagtgaaattctcctacatgtggaccatcaataactttagcttttgccgggaggaaatgggtgaagtcattaaaagttctacattttcat
  • Show more
Description: A cloning plasmid for the SPOP gene.

pCMV-SPORT6-SPOP

PVT12410 2 ug
EUR 391

Anti-SPOP (3E2)

YF-MA16346 100 ug
EUR 363
Description: Mouse monoclonal to SPOP

Rabbit Speckle Type POZ Protein (SPOP) ELISA Kit

abx362370-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Speckle Type POZ Protein (SPOP) Antibody

20-abx123223
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Speckle Type POZ Protein (SPOP) Antibody

20-abx126631
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Speckle Type POZ Protein (SPOP) Antibody

abx238189-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

SPOP Rabbit Polyclonal Antibody