SLC12A4 Rabbit Polyclonal Antibody

SLC12A4 Polyclonal Antibody
ABP57339-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of SLC12A4 from Human, Mouse, Rat. This SLC12A4 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

SLC12A4 Polyclonal Antibody
ABP57339-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of SLC12A4 from Human, Mouse, Rat. This SLC12A4 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

SLC12A4 Polyclonal Antibody
ABP57339-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of SLC12A4 from Human, Mouse, Rat. This SLC12A4 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

SLC12A4 Polyclonal Antibody
ES8332-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against SLC12A4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

SLC12A4 Polyclonal Antibody
ES8332-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against SLC12A4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

SLC12A4 antibody
70R-20299	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SLC12A4 antibody

SLC12A4 Antibody
35916-100ul	SAB	100ul	EUR 252

SLC12A4 Antibody
1-CSB-PA892363LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC12A4. Recognizes SLC12A4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SLC12A4 Antibody
1-CSB-PA560340	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SLC12A4. Recognizes SLC12A4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

SLC12A4 Antibody
1-CSB-PA572733	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SLC12A4. Recognizes SLC12A4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

SLC12A4 antibody
70R-5705	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal SLC12A4 antibody

SLC12A4 Antibody
1-CSB-PA021385GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SLC12A4. Recognizes SLC12A4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal SLC12A4 / KCC1 Antibody (Internal)
APR09976G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SLC12A4 / KCC1 (Internal). This antibody is tested and proven to work in the following applications:

SLC12A4 Polyclonal Antibody, HRP Conjugated
A68127	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

SLC12A4 Polyclonal Antibody, FITC Conjugated
A68128	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

SLC12A4 Polyclonal Antibody, Biotin Conjugated
A68129	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Polyclonal Goat Anti-KCC1 / SLC12A4 Antibody
AMM05027G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-KCC1 / SLC12A4 . This antibody is tested and proven to work in the following applications:

Slc12a4/ Rat Slc12a4 ELISA Kit
ELI-42125r	Lifescience Market	96 Tests	EUR 886

SLC12A4 Conjugated Antibody
C35916	SAB	100ul	EUR 397

anti- SLC12A4 antibody
FNab07907	FN Test	100µg	EUR 548.75
Immunogen: solute carrier family 12(potassium/chloride transporters), member 4 Uniprot ID: Q9UP95 Gene ID: 6560 Research Area: Signal Transduction
Description: Antibody raised against SLC12A4

Anti-SLC12A4 antibody
PAab07907	Lifescience Market	100 ug	EUR 386

Anti-SLC12A4 antibody
STJ97586	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to SLC12A4 (A248).

SLC12A4 siRNA
20-abx904963	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SLC12A4 siRNA
20-abx933515	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SLC12A4 siRNA
20-abx933516	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SLC12A4 Antibody, HRP conjugated
1-CSB-PA892363LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC12A4. Recognizes SLC12A4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SLC12A4 Antibody, FITC conjugated
1-CSB-PA892363LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC12A4. Recognizes SLC12A4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SLC12A4 Antibody, Biotin conjugated
1-CSB-PA892363LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC12A4. Recognizes SLC12A4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-SLC12A4/Kcc1 Antibody
A02864	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for SLC12A4 Antibody (SLC12A4) detection. Tested with WB, IHC in Human, Rat, Mouse.

Anti-KCC1 / SLC12A4 antibody
STJ71332	St John's Laboratory	100 µg	EUR 359

SLC12A4 Blocking Peptide
33R-6285	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SLC12A4 antibody, catalog no. 70R-5705

SLC12A4 cloning plasmid
CSB-CL892363HU-10ug	Cusabio	10ug	EUR 1196
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3258 Sequence: atgcctcacttcaccgtggtgccagtggacgggccgaggcgcggcgactatgacaacctcgaggggctcagttgggtggactacggggagcgcgccgagctggatgactcggacggacatggcaaccacagagagagcagcccttttctttcccccttggaggcttccagaggaa Show more
Description: A cloning plasmid for the SLC12A4 gene.

Anti-SLC12A4 (1H6)
YF-MA15449	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SLC12A4

SLC12A4 ELISA KIT|Human
EF002963	Lifescience Market	96 Tests	EUR 689

Mouse SLC12A4 shRNA Plasmid
20-abx972727	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat SLC12A4 shRNA Plasmid
20-abx985544	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human SLC12A4 shRNA Plasmid
20-abx954450	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Slc12a4 ORF Vector (Rat) (pORF)
ORF076302	ABM	1.0 ug DNA	EUR 506

SLC12A4 ORF Vector (Human) (pORF)
ORF009562	ABM	1.0 ug DNA	EUR 95

Slc12a4 ORF Vector (Mouse) (pORF)
ORF057409	ABM	1.0 ug DNA	EUR 506

Slc12a4 ORF Vector (Mouse) (pORF)
ORF057410	ABM	1.0 ug DNA	EUR 506

Rabbit Solute carrier family 12 member 4, SLC12A4 ELISA KIT
ELI-13451Ra	Lifescience Market	96 Tests	EUR 928

Solute Carrier Family 12 Member 4 (SLC12A4) Antibody
20-abx115646	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Solute Carrier Family 12 Member 4 (SLC12A4) Antibody
20-abx134381	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Solute Carrier Family 12 Member 4 (SLC12A4) Antibody
abx237907-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Solute Carrier Family 12 Member 4 (SLC12A4) Antibody
20-abx241605	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Solute Carrier Family 12 Member 4 (SLC12A4) Antibody
20-abx241606	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Solute Carrier Family 12 Member 4 (SLC12A4) Antibody
abx430102-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Solute Carrier Family 12 Member 4 (SLC12A4) Antibody
20-abx301755	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Slc12a4 sgRNA CRISPR Lentivector set (Rat)
K6795001	ABM	3 x 1.0 ug	EUR 339

SLC12A4 sgRNA CRISPR Lentivector set (Human)
K2167201	ABM	3 x 1.0 ug	EUR 339

Slc12a4 sgRNA CRISPR Lentivector set (Mouse)
K3265301	ABM	3 x 1.0 ug	EUR 339

Solute Carrier Family 12 Member 4 (SLC12A4) Antibody (HRP)
20-abx312295	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Solute Carrier Family 12 Member 4 (SLC12A4) Antibody (FITC)
20-abx312296	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Solute Carrier Family 12 Member 4 (SLC12A4) Antibody (Biotin)
20-abx312297	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Slc12a4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6795002	ABM	1.0 ug DNA	EUR 154

Slc12a4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6795003	ABM	1.0 ug DNA	EUR 154

Slc12a4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6795004	ABM	1.0 ug DNA	EUR 154

SLC12A4 sgRNA CRISPR Lentivector (Human) (Target 1)
K2167202	ABM	1.0 ug DNA	EUR 154

SLC12A4 sgRNA CRISPR Lentivector (Human) (Target 2)
K2167203	ABM	1.0 ug DNA	EUR 154

SLC12A4 sgRNA CRISPR Lentivector (Human) (Target 3)
K2167204	ABM	1.0 ug DNA	EUR 154

Slc12a4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3265302	ABM	1.0 ug DNA	EUR 154

Slc12a4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3265303	ABM	1.0 ug DNA	EUR 154

Slc12a4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3265304	ABM	1.0 ug DNA	EUR 154

SLC12A4 Protein Vector (Rat) (pPB-C-His)
PV305206	ABM	500 ng	EUR 1166

SLC12A4 Protein Vector (Rat) (pPB-N-His)
PV305207	ABM	500 ng	EUR 1166

SLC12A4 Protein Vector (Rat) (pPM-C-HA)
PV305208	ABM	500 ng	EUR 1166

SLC12A4 Protein Vector (Rat) (pPM-C-His)
PV305209	ABM	500 ng	EUR 1166

SLC12A4 Protein Vector (Human) (pPB-C-His)
PV038245	ABM	500 ng	EUR 329

SLC12A4 Protein Vector (Human) (pPB-N-His)
PV038246	ABM	500 ng	EUR 329

SLC12A4 Protein Vector (Human) (pPM-C-HA)
PV038247	ABM	500 ng	EUR 329

SLC12A4 Protein Vector (Human) (pPM-C-His)
PV038248	ABM	500 ng	EUR 329

SLC12A4 Protein Vector (Mouse) (pPB-C-His)
PV229634	ABM	500 ng	EUR 1065

SLC12A4 Protein Vector (Mouse) (pPB-N-His)
PV229635	ABM	500 ng	EUR 1065

SLC12A4 Protein Vector (Mouse) (pPM-C-HA)
PV229636	ABM	500 ng	EUR 1065

SLC12A4 Protein Vector (Mouse) (pPM-C-His)
PV229637	ABM	500 ng	EUR 1065

SLC12A4 Protein Vector (Mouse) (pPB-C-His)
PV229638	ABM	500 ng	EUR 1065

SLC12A4 Protein Vector (Mouse) (pPB-N-His)
PV229639	ABM	500 ng	EUR 1065

SLC12A4 Protein Vector (Mouse) (pPM-C-HA)
PV229640	ABM	500 ng	EUR 1065

SLC12A4 Protein Vector (Mouse) (pPM-C-His)
PV229641	ABM	500 ng	EUR 1065

Slc12a4 3'UTR Luciferase Stable Cell Line
TU118897	ABM	1.0 ml	Ask for price

Slc12a4 3'UTR GFP Stable Cell Line
TU168897	ABM	1.0 ml	Ask for price

Slc12a4 3'UTR Luciferase Stable Cell Line
TU220429	ABM	1.0 ml	Ask for price

Slc12a4 3'UTR GFP Stable Cell Line
TU270429	ABM	1.0 ml	Ask for price

SLC12A4 3'UTR GFP Stable Cell Line
TU073387	ABM	1.0 ml	EUR 1521

SLC12A4 3'UTR Luciferase Stable Cell Line
TU023387	ABM	1.0 ml	EUR 1521

SLC12A4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV690541	ABM	1.0 ug DNA	EUR 1355

SLC12A4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV690545	ABM	1.0 ug DNA	EUR 1355

SLC12A4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV690546	ABM	1.0 ug DNA	EUR 1355

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

SLC12A4 Rabbit Polyclonal Antibody