SCAMP1 Rabbit Polyclonal Antibody

SCAMP1 Polyclonal Antibody

ABP57051-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SCAMP1 at AA range: 250-330
  • Applications tips:
Description: A polyclonal antibody for detection of SCAMP1 from Human, Mouse, Rat. This SCAMP1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SCAMP1 at AA range: 250-330

SCAMP1 Polyclonal Antibody

ABP57051-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SCAMP1 at AA range: 250-330
  • Applications tips:
Description: A polyclonal antibody for detection of SCAMP1 from Human, Mouse, Rat. This SCAMP1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SCAMP1 at AA range: 250-330

SCAMP1 Polyclonal Antibody

ABP57051-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SCAMP1 at AA range: 250-330
  • Applications tips:
Description: A polyclonal antibody for detection of SCAMP1 from Human, Mouse, Rat. This SCAMP1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SCAMP1 at AA range: 250-330

SCAMP1 Polyclonal Antibody

A68703 100 ?g
EUR 628.55
Description: Ask the seller for details

SCAMP1 Rabbit pAb

A9092-100ul 100 ul
EUR 308

SCAMP1 Rabbit pAb

A9092-200ul 200 ul
EUR 459

SCAMP1 Rabbit pAb

A9092-20ul 20 ul
EUR 183

SCAMP1 Rabbit pAb

A9092-50ul 50 ul
EUR 223

SCAMP1 antibody

70R-50718 100 ul
EUR 244
Description: Purified Polyclonal SCAMP1 antibody

SCAMP1 antibody

70R-9783 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SCAMP1 antibody

Scamp1 antibody

70R-9784 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Scamp1 antibody

SCAMP1 Antibody

ABD4453 100 ug
EUR 438

SCAMP1 Antibody

47872-100ul 100ul
EUR 252

SCAMP1 antibody

70R-20095 50 ul
EUR 435
Description: Rabbit polyclonal SCAMP1 antibody

SCAMP1 Antibody

DF4453 200ul
EUR 304
Description: SCAMP1 Antibody detects endogenous levels of total SCAMP1.

SCAMP1 Antibody

1-CSB-PA080014
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SCAMP1. Recognizes SCAMP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

SCAMP1 Antibody

1-CSB-PA020750GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SCAMP1. Recognizes SCAMP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SCAMP1 Antibody

1-CSB-PA020750LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCAMP1. Recognizes SCAMP1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500

SCAMP1 Polyclonal Antibody, HRP Conjugated

A68704 100 ?g
EUR 628.55
Description: The best epigenetics products

SCAMP1 Polyclonal Antibody, FITC Conjugated

A68705 100 ?g
EUR 628.55
Description: kits suitable for this type of research

SCAMP1 Polyclonal Antibody, Biotin Conjugated

A68706 100 ?g
EUR 628.55
Description: fast delivery possible

Polyclonal Scamp1 antibody - N-terminal region

APR13201G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Scamp1 - N-terminal region. This antibody is tested and proven to work in the following applications:

SCAMP1 Conjugated Antibody

C47872 100ul
EUR 397

anti- SCAMP1 antibody

FNab07620 100µg
EUR 548.75
  • Immunogen: secretory carrier membrane protein 1
  • Uniprot ID: O15126
  • Gene ID: 9522
  • Research Area: Signal Transduction, Neuroscience
Description: Antibody raised against SCAMP1

Anti-SCAMP1 Antibody

A08692 100ul
EUR 397
Description: Rabbit Polyclonal SCAMP1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-SCAMP1 antibody

PAab07620 100 ug
EUR 386

Anti-SCAMP1 antibody

STJ95583 200 µl
EUR 197
Description: Rabbit polyclonal to SCAMP1.

Anti-SCAMP1 antibody

STJ111561 100 µl
EUR 277
Description: This gene product belongs to the SCAMP family of proteins, which are secretory carrier membrane proteins. They function as carriers to the cell surface in post-golgi recycling pathways. Different family members are highly related products of distinct genes, and are usually expressed together. These findings suggest that these protein family members may function at the same site during vesicular transport rather than in separate pathways. A pseudogene of this gene has been defined on chromosome 1. Alternative splicing results in multiple transcript variants.

Anti-SCAMP1 antibody

STJ13100375 100 µl
EUR 427

SCAMP1 siRNA

20-abx904784
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SCAMP1 siRNA

20-abx932528
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SCAMP1 siRNA

20-abx932529
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SCAMP1 Antibody, HRP conjugated

1-CSB-PA020750LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCAMP1. Recognizes SCAMP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SCAMP1 Antibody, FITC conjugated

1-CSB-PA020750LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCAMP1. Recognizes SCAMP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SCAMP1 Antibody, Biotin conjugated

1-CSB-PA020750LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCAMP1. Recognizes SCAMP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SCAMP1 cloning plasmid

CSB-CL020750HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1017
  • Sequence: atgtcggatttcgacagtaacccgtttgccgacccggatctcaacaatcccttcaaggatccatcagttacacaagtgacaagaaatgttccaccaggacttgatgaatataatccattctcggattctagaacacctccaccaggcggtgtgaagatgcctaatgtacccaata
  • Show more
Description: A cloning plasmid for the SCAMP1 gene.

SCAMP1 cloning plasmid

CSB-CL020750HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 474
  • Sequence: atgtcggatttcgacagtaacccgtttgccgacccggatctcaacaatcccttcaaggatccatcagttacacaagtgacaagaaatgttccaccaggacttgatgaatataatccattctcggattctagaacacctccaccaggcggtgtgaagatgcctaatgtacccaatac
  • Show more
Description: A cloning plasmid for the SCAMP1 gene.

SCAMP1 Blocking Peptide

20-abx063593
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Scamp1 Blocking Peptide

33R-3594 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Scamp1 antibody, catalog no. 70R-9784

SCAMP1 Blocking Peptide

33R-4861 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SCAMP1 antibody, catalog no. 70R-9783

SCAMP1 Blocking Peptide

DF4453-BP 1mg
EUR 195

pBluescriptR-SCAMP1 Plasmid

PVT15860 2 ug
EUR 325

Mouse SCAMP1 shRNA Plasmid

20-abx979838
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SCAMP1 shRNA Plasmid

20-abx985558
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SCAMP1 ELISA Kit

ELA-E9859h 96 Tests
EUR 824

SCAMP1 ELISA KIT|Human

EF006553 96 Tests
EUR 689

Human SCAMP1 shRNA Plasmid

20-abx956328
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SCAMP1 Recombinant Protein (Human)

RP027649 100 ug Ask for price

SCAMP1 Recombinant Protein (Human)

RP027652 100 ug Ask for price

SCAMP1 Recombinant Protein (Rat)

RP227552 100 ug Ask for price

SCAMP1 Recombinant Protein (Mouse)

RP170117 100 ug Ask for price

Secretory Carrier Membrane Protein 1 (SCAMP1) Antibody

20-abx115415
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

SCAMP1 ORF Vector (Human) (pORF)

ORF009217 1.0 ug DNA
EUR 95

SCAMP1 ORF Vector (Human) (pORF)

ORF009218 1.0 ug DNA
EUR 95

Scamp1 ORF Vector (Mouse) (pORF)

ORF056707 1.0 ug DNA
EUR 506

Scamp1 ORF Vector (Rat) (pORF)

ORF075852 1.0 ug DNA
EUR 506

Secretory Carrier-Associated Membrane Protein 1 (SCAMP1) Antibody

20-abx123684
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Secretory Carrier-Associated Membrane Protein 1 (SCAMP1) Antibody

20-abx119131
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Secretory Carrier-Associated Membrane Protein 1 (SCAMP1) Antibody

20-abx008413
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Secretory carrier-associated membrane protein 1 (SCAMP1) Antibody

20-abx327476
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Secretory carrier-associated membrane protein 1 (SCAMP1) Antibody

20-abx338696
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Secretory Carrier-Associated Membrane Protein 1 (SCAMP1) Antibody

abx237620-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

SCAMP1 sgRNA CRISPR Lentivector set (Human)

K2093801 3 x 1.0 ug
EUR 339

Scamp1 sgRNA CRISPR Lentivector set (Mouse)

K3044101 3 x 1.0 ug
EUR 339

Scamp1 sgRNA CRISPR Lentivector set (Rat)

K6925801 3 x 1.0 ug
EUR 339

Secretory carrier-associated membrane protein 1 (SCAMP1) Antibody (HRP)

20-abx337567
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Secretory carrier-associated membrane protein 1 (SCAMP1) Antibody (FITC)

20-abx337568
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Secretory carrier-associated membrane protein 1 (SCAMP1) Antibody (Biotin)

20-abx337569
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SCAMP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2093802 1.0 ug DNA
EUR 154

SCAMP1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2093803 1.0 ug DNA
EUR 154

SCAMP1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2093804 1.0 ug DNA
EUR 154

Scamp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3044102 1.0 ug DNA
EUR 154

Scamp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3044103 1.0 ug DNA
EUR 154

Scamp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3044104 1.0 ug DNA
EUR 154

SCAMP1 Rabbit Polyclonal Antibody