RASSF2 Rabbit Polyclonal Antibody

RASSF2 Polyclonal Antibody

ABP57099-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human RASSF2 at AA range: 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RASSF2 from Human, Mouse, Rat. This RASSF2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human RASSF2 at AA range: 80-160

RASSF2 Polyclonal Antibody

29412-100ul 100ul
EUR 252

RASSF2 Polyclonal Antibody

29412-50ul 50ul
EUR 187

RASSF2 Polyclonal Antibody

29413-100ul 100ul
EUR 252

RASSF2 Polyclonal Antibody

29413-50ul 50ul
EUR 187

RASSF2 Rabbit pAb

A15766-100ul 100 ul
EUR 308

RASSF2 Rabbit pAb

A15766-200ul 200 ul
EUR 459

RASSF2 Rabbit pAb

A15766-20ul 20 ul
EUR 183

RASSF2 Rabbit pAb

A15766-50ul 50 ul
EUR 223

RASSF2 Rabbit pAb

A15767-100ul 100 ul
EUR 308

RASSF2 Rabbit pAb

A15767-200ul 200 ul
EUR 459

RASSF2 Rabbit pAb

A15767-20ul 20 ul
EUR 183

RASSF2 Rabbit pAb

A15767-50ul 50 ul
EUR 223

Polyclonal RASSF2 Antibody (Center)

APR04840G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RASSF2 (Center). This antibody is tested and proven to work in the following applications:

RASSF2 Polyclonal Conjugated Antibody

C29412 100ul
EUR 397

RASSF2 Polyclonal Conjugated Antibody

C29413 100ul
EUR 397

RASSF2 antibody

70R-50740 100 ul
EUR 244
Description: Purified Polyclonal RASSF2 antibody

RASSF2 Antibody

ABD8437 100 ug
EUR 438

RASSF2 antibody

23100-100ul 100ul
EUR 390

RASSF2 antibody

70R-13076 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal RASSF2 antibody

RASSF2 Antibody

DF8437 200ul
EUR 304
Description: RASSF2 Antibody detects endogenous levels of total RASSF2.

RASSF2 Antibody

1-CSB-PA080062
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RASSF2. Recognizes RASSF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

RASSF2 Antibody

1-CSB-PA019374LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RASSF2. Recognizes RASSF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IP; Recommended dilution: WB:1:1000-1:5000, IP:1:200-1:2000

Polyclonal RASSF2 Antibody (N-Term)

APR04839G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RASSF2 (N-Term). This antibody is tested and proven to work in the following applications:

Rassf2/ Rat Rassf2 ELISA Kit

ELI-14099r 96 Tests
EUR 886

Anti-RASSF2 antibody

STJ95376 200 µl
EUR 197
Description: Rabbit polyclonal to RASSF2.

Anti-RASSF2 antibody

STJ118225 100 µl
EUR 277

Anti-RASSF2 antibody

STJ118226 100 µl
EUR 277

RASSF2 siRNA

20-abx904480
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RASSF2 siRNA

20-abx930966
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RASSF2 siRNA

20-abx930967
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RASSF2 Antibody, HRP conjugated

1-CSB-PA019374LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RASSF2. Recognizes RASSF2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RASSF2 Antibody, FITC conjugated

1-CSB-PA019374LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RASSF2. Recognizes RASSF2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RASSF2 Antibody, Biotin conjugated

1-CSB-PA019374LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RASSF2. Recognizes RASSF2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RASSF2 cloning plasmid

CSB-CL019374HU-10ug 10ug
EUR 384
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 981
  • Sequence: atggactacagccaccaaacgtccctagtcccatgtggacaagataaatacatttccaaaaatgaacttctcttgcatctgaagacctacaacttgtactatgaaggccagaatttacagctccggcaccgggaggaagaagacgagttcattgtggaggggctcctgaacatctc
  • Show more
Description: A cloning plasmid for the RASSF2 gene.

RASSF2 Blocking Peptide

20-abx063615
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RASSF2 Blocking Peptide

DF8437-BP 1mg
EUR 195

Monoclonal RASSF2 Antibody, Clone: 1509CT269.10.9.29

AMM02545G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human RASSF2. The antibodies are raised in Mouse and are from clone 1509CT269.10.9.29. This antibody is applicable in FC, WB, E

Mouse RASSF2 shRNA Plasmid

20-abx980942
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RASSF2 shRNA Plasmid

20-abx989674
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RASSF2 ELISA KIT

ELI-42789h 96 Tests
EUR 824

Mouse Rassf2 ELISA KIT

ELI-39170m 96 Tests
EUR 865

Human RASSF2 shRNA Plasmid

20-abx956533
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RASSF2 Recombinant Protein (Human)

RP042757 100 ug Ask for price

RASSF2 Recombinant Protein (Rat)

RP223718 100 ug Ask for price

RASSF2 Recombinant Protein (Mouse)

RP166970 100 ug Ask for price

Rassf2 ORF Vector (Rat) (pORF)

ORF074574 1.0 ug DNA
EUR 506

RASSF2 ORF Vector (Human) (pORF)

ORF014253 1.0 ug DNA
EUR 354

Rassf2 ORF Vector (Mouse) (pORF)

ORF055658 1.0 ug DNA
EUR 506

Ras Association Domain Family Member 2 (RASSF2) Antibody

abx145079-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ras Association Domain Family Member 2 (RASSF2) Antibody

20-abx008392
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Ras Association Domain Family Member 2 (RASSF2) Antibody

20-abx327652
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

RASSF2 sgRNA CRISPR Lentivector set (Human)

K1789801 3 x 1.0 ug
EUR 339

Rassf2 sgRNA CRISPR Lentivector set (Mouse)

K4064401 3 x 1.0 ug
EUR 339

Rassf2 sgRNA CRISPR Lentivector set (Rat)

K7318101 3 x 1.0 ug
EUR 339

RASSF2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1789802 1.0 ug DNA
EUR 154

RASSF2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1789803 1.0 ug DNA
EUR 154

RASSF2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1789804 1.0 ug DNA
EUR 154

Rassf2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4064402 1.0 ug DNA
EUR 154

Rassf2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4064403 1.0 ug DNA
EUR 154

Rassf2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4064404 1.0 ug DNA
EUR 154

Rassf2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7318102 1.0 ug DNA
EUR 154

Rassf2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7318103 1.0 ug DNA
EUR 154

Rassf2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7318104 1.0 ug DNA
EUR 154

RASSF2 Protein Vector (Human) (pPB-C-His)

PV057009 500 ng
EUR 481

RASSF2 Protein Vector (Human) (pPB-N-His)

PV057010 500 ng
EUR 481

RASSF2 Protein Vector (Human) (pPM-C-HA)

PV057011 500 ng
EUR 481

RASSF2 Protein Vector (Human) (pPM-C-His)

PV057012 500 ng
EUR 481

RASSF2 Protein Vector (Rat) (pPB-C-His)

PV298294 500 ng
EUR 603

RASSF2 Protein Vector (Rat) (pPB-N-His)

PV298295 500 ng
EUR 603

RASSF2 Protein Vector (Rat) (pPM-C-HA)

PV298296 500 ng
EUR 603

RASSF2 Protein Vector (Rat) (pPM-C-His)

PV298297 500 ng
EUR 603

RASSF2 Protein Vector (Mouse) (pPB-C-His)

PV222630 500 ng
EUR 603

RASSF2 Protein Vector (Mouse) (pPB-N-His)

PV222631 500 ng
EUR 603

RASSF2 Protein Vector (Mouse) (pPM-C-HA)

PV222632 500 ng
EUR 603

RASSF2 Protein Vector (Mouse) (pPM-C-His)

PV222633 500 ng
EUR 603

Rassf2 3'UTR GFP Stable Cell Line

TU167575 1.0 ml Ask for price

RASSF2 3'UTR Luciferase Stable Cell Line

TU019553 1.0 ml
EUR 2333

Rassf2 3'UTR Luciferase Stable Cell Line

TU117575 1.0 ml Ask for price

RASSF2 3'UTR GFP Stable Cell Line

TU069553 1.0 ml
EUR 2333

Rassf2 3'UTR GFP Stable Cell Line

TU267343 1.0 ml Ask for price

Rassf2 3'UTR Luciferase Stable Cell Line

TU217343 1.0 ml Ask for price

RASSF2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV653011 1.0 ug DNA
EUR 514

RASSF2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV653015 1.0 ug DNA
EUR 514

RASSF2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV653016 1.0 ug DNA
EUR 514

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

RASSF2 Rabbit Polyclonal Antibody