PRX I Rabbit Polyclonal Antibody

PRX I Polyclonal Antibody
ES4185-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PRX I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PRX I Polyclonal Antibody
ES4185-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PRX I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PRX I Polyclonal Antibody
ABP57178-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein Applications tips:
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

PRX I Polyclonal Antibody
ABP57178-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein Applications tips:
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

PRX I Polyclonal Antibody
ABP57178-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein Applications tips:
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

PRX I Polyclonal Antibody
ABP53186-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human PRX I Applications tips:
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX I

PRX I Polyclonal Antibody
ABP53186-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human PRX I Applications tips:
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX I

PRX I Polyclonal Antibody
ABP53186-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human PRX I Applications tips:
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX I

PRX I Polyclonal Antibody
41828-100ul	SAB	100ul	EUR 252

PRX I Polyclonal Antibody
41828-50ul	SAB	50ul	EUR 187

PRX I Polyclonal Conjugated Antibody
C41828	SAB	100ul	EUR 397

Anti-PRX I antibody
STJ96820	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to PRX I.

Anti-PRX I antibody
STJ97366	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to PRX I.

PRX Polyclonal Antibody
30158-100ul	SAB	100ul	EUR 252

PRX Polyclonal Antibody
30158-50ul	SAB	50ul	EUR 187

PRX Rabbit pAb
A17744-100ul	Abclonal	100 ul	EUR 308

PRX Rabbit pAb
A17744-200ul	Abclonal	200 ul	EUR 459

PRX Rabbit pAb
A17744-20ul	Abclonal	20 ul	EUR 183

PRX Rabbit pAb
A17744-50ul	Abclonal	50 ul	EUR 223

PRX Polyclonal Conjugated Antibody
C30158	SAB	100ul	EUR 397

PRX II Polyclonal Antibody
ES7361-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PRX II from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PRX II Polyclonal Antibody
ES7361-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PRX II from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PRX III Polyclonal Antibody
ES3266-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PRX III from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PRX III Polyclonal Antibody
ES3266-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PRX III from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PRX III Polyclonal Antibody
ABP52267-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human PRX III Applications tips:
Description: A polyclonal antibody for detection of PRX III from Human, Mouse, Rat. This PRX III antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX III

PRX III Polyclonal Antibody
ABP52267-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human PRX III Applications tips:
Description: A polyclonal antibody for detection of PRX III from Human, Mouse, Rat. This PRX III antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX III

PRX III Polyclonal Antibody
ABP52267-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human PRX III Applications tips:
Description: A polyclonal antibody for detection of PRX III from Human, Mouse, Rat. This PRX III antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX III

PRX II Polyclonal Antibody
ABP56362-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the C-terminal region of human PRX II Applications tips:
Description: A polyclonal antibody for detection of PRX II from Human, Mouse, Rat. This PRX II antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PRX II

PRX II Polyclonal Antibody
ABP56362-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the C-terminal region of human PRX II Applications tips:
Description: A polyclonal antibody for detection of PRX II from Human, Mouse, Rat. This PRX II antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PRX II

PRX II Polyclonal Antibody
ABP56362-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the C-terminal region of human PRX II Applications tips:
Description: A polyclonal antibody for detection of PRX II from Human, Mouse, Rat. This PRX II antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PRX II

PRX III Polyclonal Antibody
41363-100ul	SAB	100ul	EUR 252

PRX III Polyclonal Antibody
41363-50ul	SAB	50ul	EUR 187

PRX Antibody
1-CSB-PA018656GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PRX. Recognizes PRX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PRX III Polyclonal Conjugated Antibody
C41363	SAB	100ul	EUR 397

Prx/ Rat Prx ELISA Kit
ELI-19663r	Lifescience Market	96 Tests	EUR 886

Anti-PRX Antibody
A01686	BosterBio	100ug/vial	EUR 334

Prx III antibody
70R-21656	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal Prx III antibody

Anti-PRX antibody
STJ119785	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein involved in peripheral nerve myelin upkeep. The encoded protein contains 2 PDZ domains which were named after PSD95 (post synaptic density protein), DlgA (Drosophila disc large tumor suppressor), and ZO1 (a mammalian tight junction protein). Two alternatively spliced transcript variants have been described for this gene which encode different protein isoforms and which are targeted differently in the Schwann cell. Mutations in this gene cause Charcot-Marie-Tooth neuoropathy, type 4F and Dejerine-Sottas neuropathy. [provided by RefSeq, Jul 2008]

IGF-I Polyclonal Antibody (Rabbit)
PABCa	GroPep	1 mg	EUR 299

Human Kinase Library I
HKIN-I	Real Time Primers	1 set	EUR 450

Human Drug Detoxication I
HDTX-I	Real Time Primers	1 set	EUR 548

PRX siRNA
20-abx904297	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PRX-08066
B1200-5	ApexBio	5 mg	EUR 448
Description: PRX-08066 is a selective antagonist of 5-hydroxytryptamine receptor 2B (5-HT2BR) with Ki value of 3.4nM [1].PRX-08066 is found to causes selective vasodilation of pulmonary arteries and is developed to treat for pulmonary arterial hypertension (PAH).

PRX-08066
HY-15472	MedChemExpress	5mg	EUR 291

PRX siRNA
20-abx930081	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PRX siRNA
20-abx930082	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Human Cytokine Primer Library I
HCA-I	Real Time Primers	1 set	EUR 450

Mouse Cytokine Primer Library I
MCA-I	Real Time Primers	1 set	EUR 450

Rat Cytokine Primer Library I
RCA-I	Real Time Primers	1 set	EUR 548

Rabbit Anti Rig-I Polyclonal Antibody
CPBT-65259RR	Creative Diagnostics	0.1 mg	EUR 663

Human IGF-I Polyclonal Antibody (Rabbit)
PAA2	GroPep	400 µg	EUR 299

Anti-PRX II antibody
STJ95237	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to PRX II.

Anti-PRX III antibody
STJ95238	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to PRX III.

Human Colon Cancer Primer Library I
HCCP-I	Real Time Primers	1 set	EUR 548

Human DNA Repair Primer Library I
HDRL-I	Real Time Primers	1 set	EUR 548

Human Drug Transporter I Primer Library
HDTP-I	Real Time Primers	1 set	EUR 548

Mouse DNA Repair Primer Library I
MDRL-I	Real Time Primers	1 set	EUR 645

Polyclonal Rabbit anti-Troponin I
TnI	Detroit R&D	50 uL	EUR 280

Human Interferon Type I Signaling Primer Library
HIFN-I	Real Time Primers	1 set	EUR 548

Human Cancer Driver Gene I Primer Library
HCDG-I	Real Time Primers	1 set	EUR 645

Rabbit Anti-Complement Factor I Polyclonal Antibody
CTA-335-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbit anti-complement Factor I polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti-Complement Factor I Polyclonal Antibody
CTA-335-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbit anti-complement Factor I polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti Human I-Tac Polyclonal Antibody
CPBT-65168RH	Creative Diagnostics	0.1 mg	EUR 881

Rabbit Anti Chicken Collagen I Polyclonal Antibody
CPBT-67349RC	Creative Diagnostics	0.5 ml	EUR 861

Rabbit Anti Human Annexin I Polyclonal Antibody
CPBT-67390RH	Creative Diagnostics	0.1 mg	EUR 767

Rabbit Anti Human Collagen I Polyclonal Antibody
CPBT-67896RH	Creative Diagnostics	50 µg	EUR 944

Rabbit Anti Rat Collagen I Polyclonal Antibody
CPBT-67923RR	Creative Diagnostics	0.5 ml	EUR 767

Rabbit Anti Mouse Collagen I Polyclonal Antibody
CPBT-68065RM	Creative Diagnostics	0.1 ml	EUR 840

PRX cloning plasmid
CSB-CL018833HU-10ug	Cusabio	10ug	EUR 1715
Formulation: 10 μg plasmid + 200μl Glycerol Length: 4386 Sequence: atggaggccaggagccggagtgccgaggagctgaggcgggcggagttggtggaaattatcgtggagacggaggcgcagaccggggtcagcggcatcaacgtagcgggcggcggcaaagagggaatcttcgttcgggagctgcgcgaggactcacccgccgccaggagcctcagcc Show more
Description: A cloning plasmid for the PRX gene.

Rabbit Polyclonal Antibody to Human Topoisomerase I (Rabbit Serum)
TG2012-2	TopoGen	250 ul	EUR 380

Rabbit Anti Phap I (C-Terminal) Polyclonal Antibody
CPBT-66414RP	Creative Diagnostics	0.1 mg	EUR 663

Rabbit Anti Bovine Collagen I/Iii Polyclonal Antibody
CPBT-67295RB	Creative Diagnostics	0.5 ml	EUR 767

Rabbit Anti Dog Collagen I/Iii Polyclonal Antibody
CPBT-67318RD	Creative Diagnostics	0.5 ml	EUR 767

Rabbit Anti Human Collagen I/Iii Polyclonal Antibody
CPBT-67898RH	Creative Diagnostics	0.5 ml	EUR 767

Rat PRX shRNA Plasmid
20-abx986471	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PRX ELISA Kit
ELA-E13230h	Lifescience Market	96 Tests	EUR 824

PRX ELISA KIT|Human
EF005289	Lifescience Market	96 Tests	EUR 689

PRX-08066 Maleic acid
A2098-10	ApexBio	10 mg	EUR 608
Description: PRX-08066 Maleic acid is a selective 5-hydroxytryptamine receptor 2B (5-HT2BR) antagonist [1].

PRX-08066 Maleic acid
A2098-5	ApexBio	5 mg	EUR 457
Description: PRX-08066 Maleic acid is a selective 5-hydroxytryptamine receptor 2B (5-HT2BR) antagonist [1].

PRX-08066 Maleic acid
A2098-5.1	ApexBio	10 mM (in 1mL DMSO)	EUR 893
Description: PRX-08066 Maleic acid is a selective 5-hydroxytryptamine receptor 2B (5-HT2BR) antagonist [1].

Mouse PRX shRNA Plasmid
20-abx972229	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PRX shRNA Plasmid
20-abx961655	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Polyclonal IGF-I Antibody
APR00268G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IGF-I . This antibody is tested and proven to work in the following applications:

Polyclonal IGF-I Antibody
APR07952G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IGF-I . This antibody is tested and proven to work in the following applications:

Polyclonal PHAP I Antibody
APR09079G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PHAP I . This antibody is tested and proven to work in the following applications:

Polyclonal PHAP I Antibody
APR09080G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PHAP I . This antibody is tested and proven to work in the following applications:

Polyclonal Synaptotagmin-I Antibody
AMM08056G	Leading Biology	0.05ml	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Synaptotagmin-I . This antibody is tested and proven to work in the following applications:

Polyclonal Synaptotagmin I Antibody
APG00323G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Synaptotagmin I . This antibody is tested and proven to work in the following applications:

Polyclonal Synapsin I Antibody
APR13608G	Leading Biology	0.1mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Synapsin I . This antibody is tested and proven to work in the following applications:

Polyclonal Synapsin I Antibody
APR13609G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Synapsin I . This antibody is tested and proven to work in the following applications:

Polyclonal Synapsin I Antibody
APR13610G	Leading Biology	0.1ml	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Synapsin I . This antibody is tested and proven to work in the following applications:

I?B ? Polyclonal Antibody
EA213-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against I?B ? from Human/ Rat. This antibody is tested and validated for WB, ELISA, IHC

I?B ? Polyclonal Antibody
EA213-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against I?B ? from Human/ Rat. This antibody is tested and validated for WB, ELISA, IHC

Amphiphysin I Polyclonal Antibody
ES1647-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Amphiphysin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Amphiphysin I Polyclonal Antibody
ES1647-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Amphiphysin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Annexin I Polyclonal Antibody
ES1655-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Annexin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Annexin I Polyclonal Antibody
ES1655-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Annexin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Arylsulfatase I Polyclonal Antibody
ES1711-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Arylsulfatase I from Human/Monkey. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Arylsulfatase I Polyclonal Antibody
ES1711-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Arylsulfatase I from Human/Monkey. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Dynamin I Polyclonal Antibody
ES2208-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Dynamin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Dynamin I Polyclonal Antibody
ES2208-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Dynamin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

HXK I Polyclonal Antibody
ES2587-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HXK I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

HXK I Polyclonal Antibody
ES2587-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HXK I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

I?B-? Polyclonal Antibody
ES2652-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

I?B-? Polyclonal Antibody
ES2652-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

I?B-? Polyclonal Antibody
ES2653-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

I?B-? Polyclonal Antibody
ES2653-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Dynamin I Polyclonal Antibody
ES5011-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Dynamin I from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

Dynamin I Polyclonal Antibody
ES5011-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Dynamin I from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

GnRH I Polyclonal Antibody
ES5570-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against GnRH I from Human. This antibody is tested and validated for IHC, WB, ELISA

GnRH I Polyclonal Antibody
ES5570-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against GnRH I from Human. This antibody is tested and validated for IHC, WB, ELISA

Annexin I Polyclonal Antibody
ES5712-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Annexin I from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Annexin I Polyclonal Antibody
ES5712-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Annexin I from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Factor I Polyclonal Antibody
ES5825-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Factor I from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Factor I Polyclonal Antibody
ES5825-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Factor I from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

IGF-I Polyclonal Antibody
ES5845-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IGF-I from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

IGF-I Polyclonal Antibody
ES5845-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IGF-I from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

IP3R-I Polyclonal Antibody
ES5965-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IP3R-I from Human/Mouse/Rat. This antibody is tested and validated for IHC, IF, WB, ELISA

IP3R-I Polyclonal Antibody
ES5965-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IP3R-I from Human/Mouse/Rat. This antibody is tested and validated for IHC, IF, WB, ELISA

Arginase I Polyclonal Antibody
ES6028-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Arginase I from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Arginase I Polyclonal Antibody
ES6028-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Arginase I from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

I?B-? Polyclonal Antibody
ES6382-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse/Rat. This antibody is tested and validated for IHC, IF, WB, ELISA

I?B-? Polyclonal Antibody
ES6382-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse/Rat. This antibody is tested and validated for IHC, IF, WB, ELISA

I?B-? Polyclonal Antibody
ES6383-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

I?B-? Polyclonal Antibody
ES6383-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

I?B-? Polyclonal Antibody
ES6385-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

I?B-? Polyclonal Antibody
ES6385-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

I?B-? Polyclonal Antibody
ES6387-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

I?B-? Polyclonal Antibody
ES6387-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Neurophysin I Polyclonal Antibody
ES6452-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Neurophysin I from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Neurophysin I Polyclonal Antibody
ES6452-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Neurophysin I from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Endophilin I Polyclonal Antibody
ES7184-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Endophilin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Endophilin I Polyclonal Antibody
ES7184-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Endophilin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Synapsin I Polyclonal Antibody
ES7326-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Synapsin I from Human/Mouse/Rat. This antibody is tested and validated for IHC, IF, WB, ELISA

Synapsin I Polyclonal Antibody
ES7326-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Synapsin I from Human/Mouse/Rat. This antibody is tested and validated for IHC, IF, WB, ELISA

Synapsin I Polyclonal Antibody
ES7327-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Synapsin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Synapsin I Polyclonal Antibody
ES7327-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Synapsin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Topo I Polyclonal Antibody
ES7412-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Topo I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Topo I Polyclonal Antibody
ES7412-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Topo I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TTF-I Polyclonal Antibody
ES7457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against TTF-I from Human. This antibody is tested and validated for IHC, WB, ELISA

TTF-I Polyclonal Antibody
ES7457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against TTF-I from Human. This antibody is tested and validated for IHC, WB, ELISA

CA I Polyclonal Antibody
ES7542-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CA I from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CA I Polyclonal Antibody
ES7542-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CA I from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Neurexin I Polyclonal Antibody
ES8030-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Neurexin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Neurexin I Polyclonal Antibody
ES8030-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Neurexin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

I?B-? Polyclonal Antibody
ES8242-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC

I?B-? Polyclonal Antibody
ES8242-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC

IP3R-I Polyclonal Antibody
ES8348-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IP3R-I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

IP3R-I Polyclonal Antibody
ES8348-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IP3R-I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Collagen I Polyclonal Antibody
ES8487-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Collagen I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Collagen I Polyclonal Antibody
ES8487-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Collagen I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Annexin I Polyclonal Antibody
ES8636-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Annexin I from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Annexin I Polyclonal Antibody
ES8636-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Annexin I from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

I-FABP Polyclonal Antibody
ES8641-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against I-FABP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

I-FABP Polyclonal Antibody
ES8641-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against I-FABP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

ANG I Polyclonal Antibody
ES8656-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ANG I from Human. This antibody is tested and validated for IHC, WB, ELISA

ANG I Polyclonal Antibody
ES8656-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ANG I from Human. This antibody is tested and validated for IHC, WB, ELISA

Collagen I Polyclonal Antibody
ES8844-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Collagen I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Collagen I Polyclonal Antibody
ES8844-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Collagen I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Collagen I Polyclonal Antibody
ES8915-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Collagen I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Collagen I Polyclonal Antibody
ES8915-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Collagen I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PIPK I ? Polyclonal Antibody
ES3212-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PIPK I ? from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PIPK I ? Polyclonal Antibody
ES3212-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PIPK I ? from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Synapsin I Polyclonal Antibody
ES3531-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Synapsin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Synapsin I Polyclonal Antibody
ES3531-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Synapsin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

ApoA-I Polyclonal Antibody
ES4169-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ApoA-I from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

ApoA-I Polyclonal Antibody
ES4169-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ApoA-I from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

ANG I Polyclonal Antibody
ES4273-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ANG I from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

ANG I Polyclonal Antibody
ES4273-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ANG I from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Synapsin I Polyclonal Antibody
ABP52532-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9 Applications tips:
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9

Synapsin I Polyclonal Antibody
ABP52532-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9 Applications tips:
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9

Synapsin I Polyclonal Antibody
ABP52532-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9 Applications tips:
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9

Neurexin I Polyclonal Antibody
ABP57031-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human Neurexin I at AA range: 480-560 Applications tips:
Description: A polyclonal antibody for detection of Neurexin I from Human, Mouse, Rat. This Neurexin I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexin I at AA range: 480-560

Neurexin I Polyclonal Antibody
ABP57031-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human Neurexin I at AA range: 480-560 Applications tips:
Description: A polyclonal antibody for detection of Neurexin I from Human, Mouse, Rat. This Neurexin I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexin I at AA range: 480-560

Neurexin I Polyclonal Antibody
ABP57031-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human Neurexin I at AA range: 480-560 Applications tips:
Description: A polyclonal antibody for detection of Neurexin I from Human, Mouse, Rat. This Neurexin I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexin I at AA range: 480-560

IP3R-I Polyclonal Antibody
ABP57355-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764 Applications tips:
Description: A polyclonal antibody for detection of IP3R-I from Human, Mouse, Rat. This IP3R-I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764

IP3R-I Polyclonal Antibody
ABP57355-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764 Applications tips:
Description: A polyclonal antibody for detection of IP3R-I from Human, Mouse, Rat. This IP3R-I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764

IP3R-I Polyclonal Antibody
ABP57355-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764 Applications tips:
Description: A polyclonal antibody for detection of IP3R-I from Human, Mouse, Rat. This IP3R-I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764

Collagen I Polyclonal Antibody
ABP57494-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from Collagen I at AA range: 1200-1217 Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from Collagen I at AA range: 1200-1217

Collagen I Polyclonal Antibody
ABP57494-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from Collagen I at AA range: 1200-1217 Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from Collagen I at AA range: 1200-1217

Collagen I Polyclonal Antibody
ABP57494-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from Collagen I at AA range: 1200-1217 Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from Collagen I at AA range: 1200-1217

ANG I Polyclonal Antibody
ABP57761-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60 Applications tips:
Description: A polyclonal antibody for detection of ANG I from Human. This ANG I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60

ANG I Polyclonal Antibody
ABP57761-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60 Applications tips:
Description: A polyclonal antibody for detection of ANG I from Human. This ANG I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60

ANG I Polyclonal Antibody
ABP57761-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60 Applications tips:
Description: A polyclonal antibody for detection of ANG I from Human. This ANG I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60

Annexin I Polyclonal Antibody
ABP57766-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180 Applications tips:
Description: A polyclonal antibody for detection of Annexin I from Human. This Annexin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180

Annexin I Polyclonal Antibody
ABP57766-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180 Applications tips:
Description: A polyclonal antibody for detection of Annexin I from Human. This Annexin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180

Annexin I Polyclonal Antibody
ABP57766-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180 Applications tips:
Description: A polyclonal antibody for detection of Annexin I from Human. This Annexin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180

Synapsin I Polyclonal Antibody
ABP-PAB-22036	Allele Biotech	100 ug	Ask for price
Product line: Pan-specific Antibodies Brand:

I-FABP Polyclonal Antibody
ABP58874-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human I-FABP protein at amino acid sequence of 90-132 Applications tips:
Description: A polyclonal antibody for detection of I-FABP from Human, Mouse, Rat. This I-FABP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human I-FABP protein at amino acid sequence of 90-132

I-FABP Polyclonal Antibody
ABP58874-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human I-FABP protein at amino acid sequence of 90-132 Applications tips:
Description: A polyclonal antibody for detection of I-FABP from Human, Mouse, Rat. This I-FABP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human I-FABP protein at amino acid sequence of 90-132

I-FABP Polyclonal Antibody
ABP58874-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human I-FABP protein at amino acid sequence of 90-132 Applications tips:
Description: A polyclonal antibody for detection of I-FABP from Human, Mouse, Rat. This I-FABP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human I-FABP protein at amino acid sequence of 90-132

I?B-? Polyclonal Antibody
ABP55388-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22 Applications tips:
Description: A polyclonal antibody for detection of I?B-? from Human, Mouse, Rat. This I?B-? antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22

I?B-? Polyclonal Antibody
ABP55388-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22 Applications tips:
Description: A polyclonal antibody for detection of I?B-? from Human, Mouse, Rat. This I?B-? antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22

I?B-? Polyclonal Antibody
ABP55388-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22 Applications tips:
Description: A polyclonal antibody for detection of I?B-? from Human, Mouse, Rat. This I?B-? antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22

Neurophysin I Polyclonal Antibody
ABP55453-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human Neurophysin I Applications tips:
Description: A polyclonal antibody for detection of Neurophysin I from Human, Rat. This Neurophysin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurophysin I

Neurophysin I Polyclonal Antibody
ABP55453-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human Neurophysin I Applications tips:
Description: A polyclonal antibody for detection of Neurophysin I from Human, Rat. This Neurophysin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurophysin I

Neurophysin I Polyclonal Antibody
ABP55453-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human Neurophysin I Applications tips:
Description: A polyclonal antibody for detection of Neurophysin I from Human, Rat. This Neurophysin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurophysin I

Collagen I Polyclonal Antibody
ABP58229-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human Collagen I protein at amino acid sequence of 468-542 Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Collagen I protein at amino acid sequence of 468-542

Collagen I Polyclonal Antibody
ABP58229-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human Collagen I protein at amino acid sequence of 468-542 Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Collagen I protein at amino acid sequence of 468-542

Collagen I Polyclonal Antibody
ABP58229-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human Collagen I protein at amino acid sequence of 468-542 Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Collagen I protein at amino acid sequence of 468-542

Collagen I Polyclonal Antibody
ABP58230-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human Collagen I protein Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Collagen I protein

PRX I Rabbit Polyclonal Antibody