PENK Rabbit Polyclonal Antibody

Human Proenkephalin (PENK) ELISA Kit

RDR-PENK-Hu-96Tests 96 Tests
EUR 756

Mouse Proenkephalin (PENK) ELISA Kit

RDR-PENK-Mu-48Tests 48 Tests
EUR 557

Mouse Proenkephalin (PENK) ELISA Kit

RDR-PENK-Mu-96Tests 96 Tests
EUR 774

Human Proenkephalin (PENK) ELISA Kit

RD-PENK-Hu-48Tests 48 Tests
EUR 521

Human Proenkephalin (PENK) ELISA Kit

RD-PENK-Hu-96Tests 96 Tests
EUR 723

Mouse Proenkephalin (PENK) ELISA Kit

RD-PENK-Mu-48Tests 48 Tests
EUR 533

Mouse Proenkephalin (PENK) ELISA Kit

RD-PENK-Mu-96Tests 96 Tests
EUR 740

PENK Polyclonal Antibody

46755-100ul 100ul
EUR 252

PENK Polyclonal Antibody

46755-50ul 50ul
EUR 187

PENK Polyclonal Antibody

ABP57554-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic peptide from human protein at AA range: 51-100
  • Applications tips:
Description: A polyclonal antibody for detection of PENK from Human. This PENK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 51-100

PENK Polyclonal Antibody

ABP57554-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic peptide from human protein at AA range: 51-100
  • Applications tips:
Description: A polyclonal antibody for detection of PENK from Human. This PENK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 51-100

PENK Polyclonal Antibody

ABP57554-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 51-100
  • Applications tips:
Description: A polyclonal antibody for detection of PENK from Human. This PENK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 51-100

PENK Polyclonal Antibody

ES8547-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PENK from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PENK Polyclonal Antibody

ES8547-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PENK from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PENK Rabbit pAb

A6302-100ul 100 ul
EUR 308

PENK Rabbit pAb

A6302-200ul 200 ul
EUR 459

PENK Rabbit pAb

A6302-20ul 20 ul
EUR 183

PENK Rabbit pAb

A6302-50ul 50 ul
EUR 223

PENK antibody

38808-100ul 100ul
EUR 252

PENK Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against PENK. Recognizes PENK from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000

PENK antibody

70R-6226 50 ug
EUR 467
Description: Rabbit polyclonal PENK antibody raised against the middle region of PENK

Proenkephalin (PENK) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PENK (Glu25~ Phe267)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK)

Proenkephalin (PENK) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PENK (Glu25~ Phe267)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK). This antibody is labeled with APC.

Proenkephalin (PENK) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PENK (Glu25~ Phe267)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK). This antibody is labeled with Biotin.

Proenkephalin (PENK) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PENK (Glu25~ Phe267)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK). This antibody is labeled with Cy3.

Proenkephalin (PENK) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PENK (Glu25~ Phe267)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK). This antibody is labeled with FITC.

Proenkephalin (PENK) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PENK (Glu25~ Phe267)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK). This antibody is labeled with HRP.

Proenkephalin (PENK) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PENK (Glu25~ Phe267)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK). This antibody is labeled with PE.

Proenkephalin (PENK) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proenkephalin (PENK) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Proenkephalin (PENK) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Enkephalin (PENK) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Proenkephalin (PENK) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Proenkephalin (PENK) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proenkephalin (PENK) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

PENK Conjugated Antibody

C38808 100ul
EUR 397

Enkephalin (PENK) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-PENK antibody

STJ28224 100 µl
EUR 277
Description: This gene encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the pentapeptide opioids Met-enkephalin and Leu-enkephalin, which are stored in synaptic vesicles, then released into the synapse where they bind to mu- and delta-opioid receptors to modulate the perception of pain. Other non-opioid cleavage products may function in distinct biological activities.

Anti-PENK antibody

STJ98660 200 µl
EUR 197
Description: Rabbit polyclonal to PENK.

Proenkephalin (PENK) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PENK (Glu25~ Phe267)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK). This antibody is labeled with APC-Cy7.

PENK Blocking Peptide

33R-1846 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PENK antibody, catalog no. 70R-6226

PENK cloning plasmid

CSB-CL017781HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 804
  • Sequence: atggcgcggttcctgacactttgcacttggctgctgttgctcggccccgggctcctggcgaccgtgcgggccgaatgcagccaggattgcgcgacgtgcagctaccgcctagtgcgcccggccgacatcaacttcctggcttgcgtaatggaatgtgaaggtaaactgccttctct
  • Show more
Description: A cloning plasmid for the PENK gene.

Recombinant Proenkephalin (PENK)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P01210
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Proenkephalin expressed in: E.coli

Anti-PENK (9E7)

YF-MA20202 100 ug
EUR 363
Description: Mouse monoclonal to PENK

Enkephalin (PENK) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.


ELA-E0279h 96 Tests
EUR 824


EF000539 96 Tests
EUR 689

Mouse PENK shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PENK shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Proenkephalin (PENK) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Proenkephalin (PENK) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Proenkephalin (PENK) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Enkephalin (PENK) Protein (OVA)

  • EUR 258.00
  • EUR 189.00
  • EUR 537.00
  • EUR 272.00
  • EUR 217.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Enkephalin (PENK) Peptide (KLH)

  • EUR 286.00
  • EUR 203.00
  • EUR 662.00
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Enkephalin (PENK) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human PENK shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


PVT16701 2 ug
EUR 325

PENK Recombinant Protein (Human)

RP023086 100 ug Ask for price

PENK Recombinant Protein (Mouse)

RP161324 100 ug Ask for price

PENK Recombinant Protein (Rat)

RP220037 100 ug Ask for price

Human Proenkephalin (PENK)ELISA kit

201-12-2342 96 tests
EUR 440
  • This Proenkephalin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human proenkephalin (PENK) ELISA kit

CSB-EL017781HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human proenkephalin (PENK) in samples from serum, plasma, cerebrospinalfluid (CSF). A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human proenkephalin (PENK) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human proenkephalin (PENK) in samples from serum, plasma, cerebrospinalfluid(CSF). Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Proenkephalin (PENK) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Proenkephalin (PENK) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Proenkephalin (PENK) ELISA Kit

abx253776-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Proenkephalin (PENK) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

PENK Rabbit Polyclonal Antibody