OXSR1 Rabbit Polyclonal Antibody

OXSR1 Polyclonal Antibody
ABP57143-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human OXSR1 at AA range: 250-330 Applications tips:
Description: A polyclonal antibody for detection of OXSR1 from Human, Mouse. This OXSR1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human OXSR1 at AA range: 250-330

OXSR1 Polyclonal Antibody
ABP57143-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human OXSR1 at AA range: 250-330 Applications tips:
Description: A polyclonal antibody for detection of OXSR1 from Human, Mouse. This OXSR1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human OXSR1 at AA range: 250-330

OXSR1 Rabbit pAb
A15126-100ul	Abclonal	100 ul	EUR 308

OXSR1 Rabbit pAb
A15126-200ul	Abclonal	200 ul	EUR 459

OXSR1 Rabbit pAb
A15126-20ul	Abclonal	20 ul	EUR 183

OXSR1 Rabbit pAb
A15126-50ul	Abclonal	50 ul	EUR 223

OXSR1 antibody
70R-50759	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal OXSR1 antibody

OXSR1 Antibody
36674-100ul	SAB	100ul	EUR 252

OXSR1 antibody
10R-5137	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal OXSR1 antibody

OXSR1 antibody
70R-19075	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal OXSR1 antibody

OXSR1 antibody
70R-13432	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal OXSR1 antibody

OXSR1 Antibody
1-CSB-PA998479	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

OXSR1 Antibody
1-CSB-PA220770	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

OXSR1 Antibody
1-CSB-PA080105	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

OXSR1 Antibody
1-CSB-PA080106	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

OXSR1 Antibody
1-CSB-PA017314GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

OXSR1 Conjugated Antibody
C36674	SAB	100ul	EUR 397

anti- OXSR1 antibody
FNab06055	FN Test	100µg	EUR 505.25
Immunogen: oxidative-stress responsive 1 Uniprot ID: O95747 Gene ID: 9943 Research Area: Metabolism
Description: Antibody raised against OXSR1

OXSR1 (pT185) Antibody
abx333001-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

OXSR1(OSR1) antibody
22738-100ul	SAB	100ul	EUR 390

Anti-OXSR1 antibody
PAab06055	Lifescience Market	100 ug	EUR 355

Anti-OXSR1 antibody
STJ94847	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to OXSR1.

Anti-OXSR1 antibody
STJ117320	St John's Laboratory	100 µl	EUR 277
Description: The product of this gene belongs to the Ser/Thr protein kinase family of proteins. It regulates downstream kinases in response to environmental stress, and may play a role in regulating the actin cytoskeleton.

OXSR1 siRNA
20-abx927518	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

OXSR1 siRNA
20-abx927519	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-OXSR1
YF-PA16593	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to OXSR1

anti-OXSR1
YF-PA16594	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to OXSR1

anti-OXSR1
YF-PA25437	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to OXSR1

Phospho-OXSR1 (T185) Antibody
1-CSB-PA080104	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-OXSR1 (T185). Recognizes Phospho-OXSR1 (T185) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Phospho-OXSR1 (Thr185) Antibody
CSB-PA067482-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie Show more
Description: A polyclonal antibody against Phospho-OXSR1 (Thr185). Recognizes Phospho-OXSR1 (Thr185) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

Phospho-OXSR1 (Thr185) Antibody
CSB-PA067482-100ul	Cusabio	100ul	EUR 362
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie Show more
Description: A polyclonal antibody against Phospho-OXSR1 (Thr185). Recognizes Phospho-OXSR1 (Thr185) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

OXSR1 cloning plasmid
CSB-CL017314HU-10ug	Cusabio	10ug	EUR 553
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1584 Sequence: atgtccgaggactcgagcgccctgccctggtccatcaacagggacgattacgagctgcaggaggtgatcgggagtggagcaactgctgtagtccaagcagcttattgtgcccctaaaaaggagaaagtggcaatcaaacggataaaccttgagaaatgtcaaactagcatggatg Show more
Description: A cloning plasmid for the OXSR1 gene.

OXSR1 Blocking Peptide
20-abx063634	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

anti-OXSR1 (1D10)
LF-MA10396	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to OXSR1

anti-OXSR1 (5D5)
LF-MA10397	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (5E1)
YF-MA17042	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (1C8)
YF-MA17043	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (1C8)
YF-MA17044	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (2E9)
YF-MA17045	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (1F6)
YF-MA17046	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (3F6)
YF-MA17048	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (4D12)
YF-MA17049	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (1B10)
YF-MA17050	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (4C12)
YF-MA17051	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (2A5)
YF-MA17052	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (6C7)
YF-MA11223	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (4G9)
YF-MA11224	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (3A8)
YF-MA11225	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (1B9)
YF-MA11226	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to OXSR1

Oxidative-Stress Responsive 1 (OXSR1) Antibody
20-abx114290	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

OXSR1 Cell ELISA Kit
abx595437-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Mouse OXSR1 shRNA Plasmid
20-abx979928	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

OXSR1 ELISA KIT|Human
EF001485	Lifescience Market	96 Tests	EUR 689

Human OXSR1 shRNA Plasmid
20-abx956685	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

OXSR1 protein (His tag)
80R-3983	Fitzgerald	100 ug	EUR 349
Description: Recombinant Human OXSR1 protein

anti-OXSR1 (2A2-1A2)
LF-MA10395	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to OXSR1

OXSR1 Recombinant Protein (Human)
RP022333	ABM	100 ug	Ask for price

OXSR1 Recombinant Protein (Rat)
RP219032	ABM	100 ug	Ask for price

OXSR1 Recombinant Protein (Mouse)
RP159734	ABM	100 ug	Ask for price

Monoclonal OXSR1 Antibody (monoclonal) (M16), Clone: 3A8
APR17696G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human OXSR1 (monoclonal) (M16). The antibodies are raised in mouse and are from clone 3A8. This antibody is applicable in WB, IHC and IF, E

Monoclonal OXSR1 Antibody (monoclonal) (M18), Clone: 4C12
APR17697G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human OXSR1 (monoclonal) (M18). The antibodies are raised in mouse and are from clone 4C12. This antibody is applicable in WB and IF, E

Monoclonal OXSR1 Antibody (monoclonal) (M19), Clone: 1B9
APR17698G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human OXSR1 (monoclonal) (M19). The antibodies are raised in mouse and are from clone 1B9. This antibody is applicable in WB, IHC and IF, E

Serine/threonine-Protein Kinase OSR1 (OXSR1) Antibody
20-abx123890	Abbexa	EUR 411.00 EUR 592.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase OSR1 (OXSR1) Antibody
abx146245-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase OSR1 (OXSR1) Antibody
20-abx008374	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Serine/threonine-protein kinase OSR1 (OXSR1) Antibody
20-abx325277	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Serine/threonine-protein kinase OSR1 (OXSR1) Antibody
20-abx325602	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase OSR1 (OXSR1) Antibody
abx236055-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Serine/threonine-protein kinase OSR1 (OXSR1) Antibody
20-abx212012	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Serine/threonine-protein kinase OSR1 (OXSR1) Antibody
20-abx213481	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

OXSR1 ORF Vector (Human) (pORF)
ORF007445	ABM	1.0 ug DNA	EUR 95

h OXSR1 inducible lentiviral particles
LVP259	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, OXSR1, is fully sequence verified and matched to NCBI accession ID: NM_005109.2

Oxsr1 ORF Vector (Rat) (pORF)
ORF073012	ABM	1.0 ug DNA	EUR 506

Oxsr1 ORF Vector (Mouse) (pORF)
ORF053246	ABM	1.0 ug DNA	EUR 506

Monoclonal OXSR1 Antibody (monoclonal) (M01), Clone: 2A2-1A2
APR17695G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human OXSR1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2A2-1A2. This antibody is applicable in WB and IF, E

Human Oxidative Stress-Responsive 1 Protein (OXSR1) Antibody
33219-05111	AssayPro	150 ug	EUR 261

OXSR1 Colorimetric Cell-Based ELISA Kit
EKC1416	BosterBio	100ul	EUR 572

OXSR1 sgRNA CRISPR Lentivector set (Human)
K1580801	ABM	3 x 1.0 ug	EUR 339

Oxsr1 sgRNA CRISPR Lentivector set (Mouse)
K3459001	ABM	3 x 1.0 ug	EUR 339

Oxsr1 sgRNA CRISPR Lentivector set (Rat)
K6568101	ABM	3 x 1.0 ug	EUR 339

OXSR1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1580802	ABM	1.0 ug DNA	EUR 154

OXSR1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1580803	ABM	1.0 ug DNA	EUR 154

OXSR1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1580804	ABM	1.0 ug DNA	EUR 154

Oxsr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3459002	ABM	1.0 ug DNA	EUR 154

Oxsr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3459003	ABM	1.0 ug DNA	EUR 154

Oxsr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3459004	ABM	1.0 ug DNA	EUR 154

Oxsr1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6568102	ABM	1.0 ug DNA	EUR 154

Oxsr1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6568103	ABM	1.0 ug DNA	EUR 154

Oxsr1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6568104	ABM	1.0 ug DNA	EUR 154

Recombinant Human OXSR1 Protein, His, E.coli-1mg
QP12944-1mg	EnQuireBio	1mg	EUR 2757

Recombinant Human OXSR1 Protein, His, E.coli-20ug
QP12944-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human OXSR1 Protein, His, E.coli-5ug
QP12944-5ug	EnQuireBio	5ug	EUR 155

OXSR1 Protein Vector (Human) (pPB-C-His)
PV029777	ABM	500 ng	EUR 329

OXSR1 Protein Vector (Human) (pPB-N-His)
PV029778	ABM	500 ng	EUR 329

OXSR1 Protein Vector (Human) (pPM-C-HA)
PV029779	ABM	500 ng	EUR 329

OXSR1 Protein Vector (Human) (pPM-C-His)
PV029780	ABM	500 ng	EUR 329

OXSR1 Protein Vector (Mouse) (pPB-C-His)
PV212982	ABM	500 ng	EUR 603

OXSR1 Protein Vector (Mouse) (pPB-N-His)
PV212983	ABM	500 ng	EUR 603

OXSR1 Protein Vector (Mouse) (pPM-C-HA)
PV212984	ABM	500 ng	EUR 603

OXSR1 Protein Vector (Mouse) (pPM-C-His)
PV212985	ABM	500 ng	EUR 603

OXSR1 Protein Vector (Rat) (pPB-C-His)
PV292046	ABM	500 ng	EUR 603

OXSR1 Protein Vector (Rat) (pPB-N-His)
PV292047	ABM	500 ng	EUR 603

OXSR1 Protein Vector (Rat) (pPM-C-HA)
PV292048	ABM	500 ng	EUR 603

OXSR1 Protein Vector (Rat) (pPM-C-His)
PV292049	ABM	500 ng	EUR 603

Oxsr1 3'UTR GFP Stable Cell Line
TU165803	ABM	1.0 ml	Ask for price

OXSR1 3'UTR Luciferase Stable Cell Line
TU017242	ABM	1.0 ml	EUR 1521

Oxsr1 3'UTR Luciferase Stable Cell Line
TU115803	ABM	1.0 ml	Ask for price

OXSR1 3'UTR GFP Stable Cell Line
TU067242	ABM	1.0 ml	EUR 1521

Oxsr1 3'UTR GFP Stable Cell Line
TU265717	ABM	1.0 ml	Ask for price

Oxsr1 3'UTR Luciferase Stable Cell Line
TU215717	ABM	1.0 ml	Ask for price

Serine/threonine-protein kinase OSR1 Phospho-Thr185 (OXSR1 pT185) Antibody
20-abx325747	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Human Oxidative Stress-Responsive 1 Protein (OXSR1) Antibody (Biotin Conjugate)
33219-05121	AssayPro	150 ug	EUR 369

OXSR1 Oxidative Stress Responsive 1 Human Recombinant Protein
PROTO95747	BosterBio	Regular: 20ug	EUR 317
Description: OXSR1 Human Recombinant produced in E. coli is a single polypeptide chain containing 550 amino acids (1-527) and having a molecular mass of 60.4kDa.;OXSR1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

OXSR1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV792259	ABM	1.0 ug DNA	EUR 316

OXSR1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV792260	ABM	1.0 ug DNA	EUR 316

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

OXSR1 Rabbit Polyclonal Antibody