OXSR1 Rabbit Polyclonal Antibody

OXSR1 Polyclonal Antibody

ES8142-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against OXSR1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

OXSR1 Polyclonal Antibody

ES8142-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against OXSR1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

OXSR1 Rabbit pAb

A15126-100ul 100 ul
EUR 308

OXSR1 Rabbit pAb

A15126-200ul 200 ul
EUR 459

OXSR1 Rabbit pAb

A15126-20ul 20 ul
EUR 183

OXSR1 Rabbit pAb

A15126-50ul 50 ul
EUR 223

OXSR1 antibody

70R-19075 50 ul
EUR 435
Description: Rabbit polyclonal OXSR1 antibody

OXSR1 antibody

70R-13432 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal OXSR1 antibody

OXSR1 Antibody

36674-100ul 100ul
EUR 252

OXSR1 antibody

10R-5137 100 ul
EUR 726
Description: Mouse monoclonal OXSR1 antibody

OXSR1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

OXSR1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

OXSR1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

OXSR1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

OXSR1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

OXSR1 antibody

70R-50759 100 ul
EUR 244
Description: Purified Polyclonal OXSR1 antibody

OXSR1(OSR1) antibody

22738-100ul 100ul
EUR 390

OXSR1 Conjugated Antibody

C36674 100ul
EUR 397

OXSR1 (pT185) Antibody

abx333001-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

anti- OXSR1 antibody

FNab06055 100µg
EUR 505.25
  • Immunogen: oxidative-stress responsive 1
  • Uniprot ID: O95747
  • Gene ID: 9943
  • Research Area: Metabolism
Description: Antibody raised against OXSR1

Anti-OXSR1 antibody

PAab06055 100 ug
EUR 355

Anti-OXSR1 antibody

STJ117320 100 µl
EUR 277
Description: The product of this gene belongs to the Ser/Thr protein kinase family of proteins. It regulates downstream kinases in response to environmental stress, and may play a role in regulating the actin cytoskeleton.

Anti-OXSR1 antibody

STJ94847 200 µl
EUR 197
Description: Rabbit polyclonal to OXSR1.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA16593 50 ul
EUR 363
Description: Mouse polyclonal to OXSR1


YF-PA16594 100 ug
EUR 403
Description: Rabbit polyclonal to OXSR1


YF-PA25437 50 ul
EUR 334
Description: Mouse polyclonal to OXSR1

Phospho-OXSR1 (Thr185) Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-OXSR1 (Thr185). Recognizes Phospho-OXSR1 (Thr185) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

Phospho-OXSR1 (Thr185) Antibody

CSB-PA067482-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-OXSR1 (Thr185). Recognizes Phospho-OXSR1 (Thr185) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

Phospho-OXSR1 (T185) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-OXSR1 (T185). Recognizes Phospho-OXSR1 (T185) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

OXSR1 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

OXSR1 cloning plasmid

CSB-CL017314HU-10ug 10ug
EUR 553
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1584
  • Sequence: atgtccgaggactcgagcgccctgccctggtccatcaacagggacgattacgagctgcaggaggtgatcgggagtggagcaactgctgtagtccaagcagcttattgtgcccctaaaaaggagaaagtggcaatcaaacggataaaccttgagaaatgtcaaactagcatggatg
  • Show more
Description: A cloning plasmid for the OXSR1 gene.

anti-OXSR1 (1D10)

LF-MA10396 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

anti-OXSR1 (5D5)

LF-MA10397 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (6C7)

YF-MA11223 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (4G9)

YF-MA11224 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (3A8)

YF-MA11225 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (1B9)

YF-MA11226 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (5E1)

YF-MA17042 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (1C8)

YF-MA17043 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (1C8)

YF-MA17044 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (2E9)

YF-MA17045 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (1F6)

YF-MA17046 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (3F6)

YF-MA17048 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (4D12)

YF-MA17049 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (1B10)

YF-MA17050 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (4C12)

YF-MA17051 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (2A5)

YF-MA17052 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Oxidative-Stress Responsive 1 (OXSR1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

OXSR1 protein (His tag)

80R-3983 100 ug
EUR 349
Description: Recombinant Human OXSR1 protein


EF001485 96 Tests
EUR 689


abx595437-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Human OXSR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse OXSR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

anti-OXSR1 (2A2-1A2)

LF-MA10395 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

OXSR1 Recombinant Protein (Human)

RP022333 100 ug Ask for price

OXSR1 Recombinant Protein (Mouse)

RP159734 100 ug Ask for price

OXSR1 Recombinant Protein (Rat)

RP219032 100 ug Ask for price

Serine/threonine-Protein Kinase OSR1 (OXSR1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Serine/threonine-protein kinase OSR1 (OXSR1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/threonine-protein kinase OSR1 (OXSR1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase OSR1 (OXSR1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase OSR1 (OXSR1) Antibody

abx146245-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Monoclonal OXSR1 Antibody (monoclonal) (M16), Clone: 3A8

APR17696G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human OXSR1 (monoclonal) (M16). The antibodies are raised in mouse and are from clone 3A8. This antibody is applicable in WB, IHC and IF, E

Monoclonal OXSR1 Antibody (monoclonal) (M18), Clone: 4C12

APR17697G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human OXSR1 (monoclonal) (M18). The antibodies are raised in mouse and are from clone 4C12. This antibody is applicable in WB and IF, E

Monoclonal OXSR1 Antibody (monoclonal) (M19), Clone: 1B9

APR17698G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human OXSR1 (monoclonal) (M19). The antibodies are raised in mouse and are from clone 1B9. This antibody is applicable in WB, IHC and IF, E

Serine/threonine-Protein Kinase OSR1 (OXSR1) Antibody

abx236055-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Serine/threonine-protein kinase OSR1 (OXSR1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine/threonine-protein kinase OSR1 (OXSR1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Oxsr1 ORF Vector (Rat) (pORF)

ORF073012 1.0 ug DNA
EUR 506

h OXSR1 inducible lentiviral particles

LVP259 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, OXSR1, is fully sequence verified and matched to NCBI accession ID: NM_005109.2

OXSR1 ORF Vector (Human) (pORF)

ORF007445 1.0 ug DNA
EUR 95

Oxsr1 ORF Vector (Mouse) (pORF)

ORF053246 1.0 ug DNA
EUR 506

OXSR1 ELISA Kit (Human) (OKEH08534)

OKEH08534 96 Wells
EUR 896
Description: Description of target: The product of this gene belongs to the Ser/Thr protein kinase family of proteins. It regulates downstream kinases in response to environmental stress, and may play a role in regulating the actin cytoskeleton.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078ng/mL

Human Oxidative Stress-Responsive 1 Protein (OXSR1) Antibody

33219-05111 150 ug
EUR 261

Monoclonal OXSR1 Antibody (monoclonal) (M01), Clone: 2A2-1A2

APR17695G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human OXSR1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2A2-1A2. This antibody is applicable in WB and IF, E

OXSR1 Colorimetric Cell-Based ELISA Kit

EKC1416 100ul
EUR 572

Oxsr1 sgRNA CRISPR Lentivector set (Rat)

K6568101 3 x 1.0 ug
EUR 339

Oxsr1 sgRNA CRISPR Lentivector set (Mouse)

K3459001 3 x 1.0 ug
EUR 339

OXSR1 sgRNA CRISPR Lentivector set (Human)

K1580801 3 x 1.0 ug
EUR 339

Oxsr1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6568102 1.0 ug DNA
EUR 154

Oxsr1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6568103 1.0 ug DNA
EUR 154

Oxsr1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6568104 1.0 ug DNA
EUR 154

Oxsr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3459002 1.0 ug DNA
EUR 154

Oxsr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3459003 1.0 ug DNA
EUR 154

Oxsr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3459004 1.0 ug DNA
EUR 154

OXSR1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1580802 1.0 ug DNA
EUR 154

OXSR1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1580803 1.0 ug DNA
EUR 154

OXSR1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1580804 1.0 ug DNA
EUR 154

OXSR1 Protein Vector (Rat) (pPB-C-His)

PV292046 500 ng
EUR 603

OXSR1 Protein Vector (Rat) (pPB-N-His)

PV292047 500 ng
EUR 603

OXSR1 Protein Vector (Rat) (pPM-C-HA)

PV292048 500 ng
EUR 603

OXSR1 Protein Vector (Rat) (pPM-C-His)

PV292049 500 ng
EUR 603

OXSR1 Protein Vector (Mouse) (pPB-C-His)

PV212982 500 ng
EUR 603

OXSR1 Protein Vector (Mouse) (pPB-N-His)

PV212983 500 ng
EUR 603

OXSR1 Protein Vector (Mouse) (pPM-C-HA)

PV212984 500 ng
EUR 603

OXSR1 Protein Vector (Mouse) (pPM-C-His)

PV212985 500 ng
EUR 603

OXSR1 Protein Vector (Human) (pPB-C-His)

PV029777 500 ng
EUR 329

OXSR1 Protein Vector (Human) (pPB-N-His)

PV029778 500 ng
EUR 329

OXSR1 Protein Vector (Human) (pPM-C-HA)

PV029779 500 ng
EUR 329

OXSR1 Protein Vector (Human) (pPM-C-His)

PV029780 500 ng
EUR 329

Recombinant Human OXSR1 Protein, His, E.coli-1mg

QP12944-1mg 1mg
EUR 2757

Recombinant Human OXSR1 Protein, His, E.coli-20ug

QP12944-20ug 20ug
EUR 201

Recombinant Human OXSR1 Protein, His, E.coli-5ug

QP12944-5ug 5ug
EUR 155

Oxsr1 3'UTR Luciferase Stable Cell Line

TU115803 1.0 ml Ask for price

Oxsr1 3'UTR GFP Stable Cell Line

TU165803 1.0 ml Ask for price

Oxsr1 3'UTR GFP Stable Cell Line

TU265717 1.0 ml Ask for price

Oxsr1 3'UTR Luciferase Stable Cell Line

TU215717 1.0 ml Ask for price

OXSR1 3'UTR GFP Stable Cell Line

TU067242 1.0 ml
EUR 1521

OXSR1 3'UTR Luciferase Stable Cell Line

TU017242 1.0 ml
EUR 1521

OXSR1 Colorimetric Cell-Based ELISA Kit (OKAG00926)

OKAG00926 96 Wells
EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: None
Detection Method: Colorimetric 450 nm;Sensitivity:

Human Oxidative Stress-Responsive 1 Protein (OXSR1) Antibody (Biotin Conjugate)

33219-05121 150 ug
EUR 369

Serine/threonine-protein kinase OSR1 Phospho-Thr185 (OXSR1 pT185) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

OXSR1 Rabbit Polyclonal Antibody