OXSR1 Rabbit Polyclonal Antibody

OXSR1 Polyclonal Antibody

ABP57143-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human OXSR1 at AA range: 250-330
  • Applications tips:
Description: A polyclonal antibody for detection of OXSR1 from Human, Mouse. This OXSR1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human OXSR1 at AA range: 250-330

OXSR1 Polyclonal Antibody

ABP57143-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human OXSR1 at AA range: 250-330
  • Applications tips:
Description: A polyclonal antibody for detection of OXSR1 from Human, Mouse. This OXSR1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human OXSR1 at AA range: 250-330

OXSR1 Rabbit pAb

A15126-100ul 100 ul
EUR 308

OXSR1 Rabbit pAb

A15126-200ul 200 ul
EUR 459

OXSR1 Rabbit pAb

A15126-20ul 20 ul
EUR 183

OXSR1 Rabbit pAb

A15126-50ul 50 ul
EUR 223

OXSR1 antibody

70R-50759 100 ul
EUR 244
Description: Purified Polyclonal OXSR1 antibody

OXSR1 Antibody

36674-100ul 100ul
EUR 252

OXSR1 antibody

10R-5137 100 ul
EUR 726
Description: Mouse monoclonal OXSR1 antibody

OXSR1 antibody

70R-19075 50 ul
EUR 435
Description: Rabbit polyclonal OXSR1 antibody

OXSR1 antibody

70R-13432 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal OXSR1 antibody

OXSR1 Antibody

1-CSB-PA998479
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

OXSR1 Antibody

1-CSB-PA220770
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

OXSR1 Antibody

1-CSB-PA080105
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

OXSR1 Antibody

1-CSB-PA080106
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

OXSR1 Antibody

1-CSB-PA017314GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

OXSR1 Conjugated Antibody

C36674 100ul
EUR 397

anti- OXSR1 antibody

FNab06055 100µg
EUR 505.25
  • Immunogen: oxidative-stress responsive 1
  • Uniprot ID: O95747
  • Gene ID: 9943
  • Research Area: Metabolism
Description: Antibody raised against OXSR1

OXSR1 (pT185) Antibody

abx333001-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

OXSR1(OSR1) antibody

22738-100ul 100ul
EUR 390

Anti-OXSR1 antibody

PAab06055 100 ug
EUR 355

Anti-OXSR1 antibody

STJ94847 200 µl
EUR 197
Description: Rabbit polyclonal to OXSR1.

Anti-OXSR1 antibody

STJ117320 100 µl
EUR 277
Description: The product of this gene belongs to the Ser/Thr protein kinase family of proteins. It regulates downstream kinases in response to environmental stress, and may play a role in regulating the actin cytoskeleton.

OXSR1 siRNA

20-abx927518
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

OXSR1 siRNA

20-abx927519
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-OXSR1

YF-PA16593 50 ul
EUR 363
Description: Mouse polyclonal to OXSR1

anti-OXSR1

YF-PA16594 100 ug
EUR 403
Description: Rabbit polyclonal to OXSR1

anti-OXSR1

YF-PA25437 50 ul
EUR 334
Description: Mouse polyclonal to OXSR1

Phospho-OXSR1 (T185) Antibody

1-CSB-PA080104
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-OXSR1 (T185). Recognizes Phospho-OXSR1 (T185) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Phospho-OXSR1 (Thr185) Antibody

CSB-PA067482-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-OXSR1 (Thr185). Recognizes Phospho-OXSR1 (Thr185) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

Phospho-OXSR1 (Thr185) Antibody

CSB-PA067482-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-OXSR1 (Thr185). Recognizes Phospho-OXSR1 (Thr185) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

OXSR1 cloning plasmid

CSB-CL017314HU-10ug 10ug
EUR 553
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1584
  • Sequence: atgtccgaggactcgagcgccctgccctggtccatcaacagggacgattacgagctgcaggaggtgatcgggagtggagcaactgctgtagtccaagcagcttattgtgcccctaaaaaggagaaagtggcaatcaaacggataaaccttgagaaatgtcaaactagcatggatg
  • Show more
Description: A cloning plasmid for the OXSR1 gene.

OXSR1 Blocking Peptide

20-abx063634
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

anti-OXSR1 (1D10)

LF-MA10396 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

anti-OXSR1 (5D5)

LF-MA10397 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (5E1)

YF-MA17042 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (1C8)

YF-MA17043 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (1C8)

YF-MA17044 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (2E9)

YF-MA17045 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (1F6)

YF-MA17046 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (3F6)

YF-MA17048 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (4D12)

YF-MA17049 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (1B10)

YF-MA17050 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (4C12)

YF-MA17051 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (2A5)

YF-MA17052 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (6C7)

YF-MA11223 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (4G9)

YF-MA11224 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (3A8)

YF-MA11225 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Anti-OXSR1 (1B9)

YF-MA11226 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

Oxidative-Stress Responsive 1 (OXSR1) Antibody

20-abx114290
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

OXSR1 Cell ELISA Kit

abx595437-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Mouse OXSR1 shRNA Plasmid

20-abx979928
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

OXSR1 ELISA KIT|Human

EF001485 96 Tests
EUR 689

Human OXSR1 shRNA Plasmid

20-abx956685
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

OXSR1 protein (His tag)

80R-3983 100 ug
EUR 349
Description: Recombinant Human OXSR1 protein

anti-OXSR1 (2A2-1A2)

LF-MA10395 100 ug
EUR 363
Description: Mouse monoclonal to OXSR1

OXSR1 Recombinant Protein (Human)

RP022333 100 ug Ask for price

OXSR1 Recombinant Protein (Rat)

RP219032 100 ug Ask for price

OXSR1 Recombinant Protein (Mouse)

RP159734 100 ug Ask for price

Monoclonal OXSR1 Antibody (monoclonal) (M16), Clone: 3A8

APR17696G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human OXSR1 (monoclonal) (M16). The antibodies are raised in mouse and are from clone 3A8. This antibody is applicable in WB, IHC and IF, E

Monoclonal OXSR1 Antibody (monoclonal) (M18), Clone: 4C12

APR17697G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human OXSR1 (monoclonal) (M18). The antibodies are raised in mouse and are from clone 4C12. This antibody is applicable in WB and IF, E

Monoclonal OXSR1 Antibody (monoclonal) (M19), Clone: 1B9

APR17698G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human OXSR1 (monoclonal) (M19). The antibodies are raised in mouse and are from clone 1B9. This antibody is applicable in WB, IHC and IF, E

Serine/threonine-Protein Kinase OSR1 (OXSR1) Antibody

20-abx123890
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase OSR1 (OXSR1) Antibody

abx146245-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase OSR1 (OXSR1) Antibody

20-abx008374
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Serine/threonine-protein kinase OSR1 (OXSR1) Antibody

20-abx325277
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine/threonine-protein kinase OSR1 (OXSR1) Antibody

20-abx325602
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase OSR1 (OXSR1) Antibody

abx236055-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Serine/threonine-protein kinase OSR1 (OXSR1) Antibody

20-abx212012
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/threonine-protein kinase OSR1 (OXSR1) Antibody

20-abx213481
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

OXSR1 ORF Vector (Human) (pORF)

ORF007445 1.0 ug DNA
EUR 95

h OXSR1 inducible lentiviral particles

LVP259 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, OXSR1, is fully sequence verified and matched to NCBI accession ID: NM_005109.2

Oxsr1 ORF Vector (Rat) (pORF)

ORF073012 1.0 ug DNA
EUR 506

Oxsr1 ORF Vector (Mouse) (pORF)

ORF053246 1.0 ug DNA
EUR 506

Monoclonal OXSR1 Antibody (monoclonal) (M01), Clone: 2A2-1A2

APR17695G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human OXSR1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2A2-1A2. This antibody is applicable in WB and IF, E

Human Oxidative Stress-Responsive 1 Protein (OXSR1) Antibody

33219-05111 150 ug
EUR 261

OXSR1 Colorimetric Cell-Based ELISA Kit

EKC1416 100ul
EUR 572

OXSR1 sgRNA CRISPR Lentivector set (Human)

K1580801 3 x 1.0 ug
EUR 339

Oxsr1 sgRNA CRISPR Lentivector set (Mouse)

K3459001 3 x 1.0 ug
EUR 339

Oxsr1 sgRNA CRISPR Lentivector set (Rat)

K6568101 3 x 1.0 ug
EUR 339

OXSR1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1580802 1.0 ug DNA
EUR 154

OXSR1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1580803 1.0 ug DNA
EUR 154

OXSR1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1580804 1.0 ug DNA
EUR 154

Oxsr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3459002 1.0 ug DNA
EUR 154

Oxsr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3459003 1.0 ug DNA
EUR 154

Oxsr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3459004 1.0 ug DNA
EUR 154

Oxsr1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6568102 1.0 ug DNA
EUR 154

Oxsr1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6568103 1.0 ug DNA
EUR 154

Oxsr1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6568104 1.0 ug DNA
EUR 154

Recombinant Human OXSR1 Protein, His, E.coli-1mg

QP12944-1mg 1mg
EUR 2757

Recombinant Human OXSR1 Protein, His, E.coli-20ug

QP12944-20ug 20ug
EUR 201

Recombinant Human OXSR1 Protein, His, E.coli-5ug

QP12944-5ug 5ug
EUR 155

OXSR1 Protein Vector (Human) (pPB-C-His)

PV029777 500 ng
EUR 329

OXSR1 Protein Vector (Human) (pPB-N-His)

PV029778 500 ng
EUR 329

OXSR1 Protein Vector (Human) (pPM-C-HA)

PV029779 500 ng
EUR 329

OXSR1 Protein Vector (Human) (pPM-C-His)

PV029780 500 ng
EUR 329

OXSR1 Protein Vector (Mouse) (pPB-C-His)

PV212982 500 ng
EUR 603

OXSR1 Protein Vector (Mouse) (pPB-N-His)

PV212983 500 ng
EUR 603

OXSR1 Protein Vector (Mouse) (pPM-C-HA)

PV212984 500 ng
EUR 603

OXSR1 Protein Vector (Mouse) (pPM-C-His)

PV212985 500 ng
EUR 603

OXSR1 Protein Vector (Rat) (pPB-C-His)

PV292046 500 ng
EUR 603

OXSR1 Protein Vector (Rat) (pPB-N-His)

PV292047 500 ng
EUR 603

OXSR1 Protein Vector (Rat) (pPM-C-HA)

PV292048 500 ng
EUR 603

OXSR1 Protein Vector (Rat) (pPM-C-His)

PV292049 500 ng
EUR 603

Oxsr1 3'UTR GFP Stable Cell Line

TU165803 1.0 ml Ask for price

OXSR1 3'UTR Luciferase Stable Cell Line

TU017242 1.0 ml
EUR 1521

Oxsr1 3'UTR Luciferase Stable Cell Line

TU115803 1.0 ml Ask for price

OXSR1 3'UTR GFP Stable Cell Line

TU067242 1.0 ml
EUR 1521

Oxsr1 3'UTR GFP Stable Cell Line

TU265717 1.0 ml Ask for price

Oxsr1 3'UTR Luciferase Stable Cell Line

TU215717 1.0 ml Ask for price

Serine/threonine-protein kinase OSR1 Phospho-Thr185 (OXSR1 pT185) Antibody

20-abx325747
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Oxidative Stress-Responsive 1 Protein (OXSR1) Antibody (Biotin Conjugate)

33219-05121 150 ug
EUR 369

OXSR1 Oxidative Stress Responsive 1 Human Recombinant Protein

PROTO95747 Regular: 20ug
EUR 317
Description: OXSR1 Human Recombinant produced in E. coli is a single polypeptide chain containing 550 amino acids (1-527) and having a molecular mass of 60.4kDa.;OXSR1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

OXSR1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV792259 1.0 ug DNA
EUR 316

OXSR1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV792260 1.0 ug DNA
EUR 316

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

OXSR1 Rabbit Polyclonal Antibody