Nup93 Rabbit Polyclonal Antibody

Nup93 Polyclonal Antibody

ES8086-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nup93 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Nup93 Polyclonal Antibody

ES8086-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nup93 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NUP93 Rabbit pAb

A4333-100ul 100 ul
EUR 308

NUP93 Rabbit pAb

A4333-200ul 200 ul
EUR 459

NUP93 Rabbit pAb

A4333-20ul 20 ul
EUR 183

NUP93 Rabbit pAb

A4333-50ul 50 ul
EUR 223

NUP93 Polyclonal Conjugated Antibody

C30548 100ul
EUR 397

NUP93 antibody

70R-19008 50 ul
EUR 435
Description: Rabbit polyclonal NUP93 antibody

NUP93 antibody

10R-1445 100 ug
EUR 512
Description: Mouse monoclonal NUP93 antibody

NUP93 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

NUP93 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

NUP93 Antibody

DF4252 200ul
EUR 304
Description: NUP93 Antibody detects endogenous levels of total NUP93.

NUP93 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NUP93 Antibody

ABD4252 100 ug
EUR 438

Polyclonal NUP93 Antibody (C-Term)

APR17625G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NUP93 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal NUP93 Antibody (N-Term)

APR17626G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NUP93 (N-Term). This antibody is tested and proven to work in the following applications:

Nup93/ Rat Nup93 ELISA Kit

ELI-22433r 96 Tests
EUR 886

Anti-NUP93 Antibody

A07090 100ul
EUR 397
Description: Rabbit Polyclonal NUP93 Antibody. Validated in WB and tested in Human, Mouse, Rat.

anti- NUP93 antibody

FNab05931 100µg
EUR 548.75
  • Immunogen: nucleoporin 93kDa
  • Uniprot ID: Q8N1F7
  • Gene ID: 9688
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against NUP93

Anti-NUP93 antibody

PAab05931 100 ug
EUR 386

Anti-NUP93 antibody

STJ24852 100 µl
EUR 277
Description: The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene encodes a nucleoporin protein that localizes both to the basket of the pore and to the nuclear entry of the central gated channel of the pore. The encoded protein is a target of caspase cysteine proteases that play a central role in programmed cell death by apoptosis. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-Nup93 antibody

STJ94577 200 µl
EUR 197
Description: Rabbit polyclonal to Nup93.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NUP93 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NUP93 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NUP93 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Nucleoporin 93 (NUP93) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody

abx235931-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Nucleoporin 93 (NUP93) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NUP93 Blocking Peptide

DF4252-BP 1mg
EUR 195

NUP93 cloning plasmid

CSB-CL822683HU-10ug 10ug
EUR 798
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2460
  • Sequence: atggatactgaggggtttggtgagctccttcagcaagctgaacagcttgctgctgagactgagggcatctcagagcttccccatgtggaacggaacttacaggagatccagcaggcgggagagcgcctgcgttcccgtaccctaacacgcacgtcccaggagacggcagatgtca
  • Show more
Description: A cloning plasmid for the NUP93 gene.

Nucleoporin 93 kDa (NUP93) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Bovine Nuclear pore complex protein Nup93, NUP93 ELISA KIT

ELI-44229b 96 Tests
EUR 928

Mouse Nuclear pore complex protein Nup93, Nup93 ELISA KIT

ELI-44561m 96 Tests
EUR 865

Human Nuclear pore complex protein Nup93, NUP93 ELISA KIT

ELI-36781h 96 Tests
EUR 824


EF001396 96 Tests
EUR 689

Rat NUP93 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NUP93 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NUP93 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


PVT17940 2 ug
EUR 258

NUP93 Recombinant Protein (Human)

RP021943 100 ug Ask for price

NUP93 Recombinant Protein (Mouse)

RP155525 100 ug Ask for price

NUP93 Recombinant Protein (Rat)

RP214877 100 ug Ask for price

Nup93 ORF Vector (Rat) (pORF)

ORF071627 1.0 ug DNA
EUR 506

NUP93 ORF Vector (Human) (pORF)

ORF007315 1.0 ug DNA
EUR 95

Nup93 ORF Vector (Mouse) (pORF)

ORF051843 1.0 ug DNA
EUR 506

Nup93 sgRNA CRISPR Lentivector set (Mouse)

K4879401 3 x 1.0 ug
EUR 339

Nup93 sgRNA CRISPR Lentivector set (Rat)

K6522901 3 x 1.0 ug
EUR 339

NUP93 sgRNA CRISPR Lentivector set (Human)

K1468601 3 x 1.0 ug
EUR 339

Human Nucleoporin 93kDa(NUP93)ELISA Kit

QY-E05178 96T
EUR 361

Human Nucleoporin 93 kDa (NUP93) ELISA Kit

abx381937-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Nup93 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4879402 1.0 ug DNA
EUR 154

Nup93 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4879403 1.0 ug DNA
EUR 154

Nup93 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4879404 1.0 ug DNA
EUR 154

Nup93 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6522902 1.0 ug DNA
EUR 154

Nup93 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6522903 1.0 ug DNA
EUR 154

Nup93 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6522904 1.0 ug DNA
EUR 154

NUP93 sgRNA CRISPR Lentivector (Human) (Target 1)

K1468602 1.0 ug DNA
EUR 154

NUP93 sgRNA CRISPR Lentivector (Human) (Target 2)

K1468603 1.0 ug DNA
EUR 154

NUP93 sgRNA CRISPR Lentivector (Human) (Target 3)

K1468604 1.0 ug DNA
EUR 154

NUP93 Protein Vector (Rat) (pPB-C-His)

PV286506 500 ng
EUR 1166

NUP93 Protein Vector (Rat) (pPB-N-His)

PV286507 500 ng
EUR 1166

NUP93 Protein Vector (Rat) (pPM-C-HA)

PV286508 500 ng
EUR 1166

NUP93 Protein Vector (Rat) (pPM-C-His)

PV286509 500 ng
EUR 1166

NUP93 Protein Vector (Mouse) (pPB-C-His)

PV207370 500 ng
EUR 1065

NUP93 Protein Vector (Mouse) (pPB-N-His)

PV207371 500 ng
EUR 1065

NUP93 Protein Vector (Mouse) (pPM-C-HA)

PV207372 500 ng
EUR 1065

NUP93 Protein Vector (Mouse) (pPM-C-His)

PV207373 500 ng
EUR 1065

NUP93 Protein Vector (Human) (pPB-C-His)

PV029257 500 ng
EUR 329

NUP93 Protein Vector (Human) (pPB-N-His)

PV029258 500 ng
EUR 329

NUP93 Protein Vector (Human) (pPM-C-HA)

PV029259 500 ng
EUR 329

NUP93 Protein Vector (Human) (pPM-C-His)

PV029260 500 ng
EUR 329

Nup93 3'UTR Luciferase Stable Cell Line

TU114448 1.0 ml Ask for price

Nup93 3'UTR GFP Stable Cell Line

TU164448 1.0 ml Ask for price

Nup93 3'UTR Luciferase Stable Cell Line

TU214309 1.0 ml Ask for price

Nup93 3'UTR GFP Stable Cell Line

TU264309 1.0 ml Ask for price

NUP93 3'UTR GFP Stable Cell Line

TU066107 1.0 ml
EUR 1394

NUP93 3'UTR Luciferase Stable Cell Line

TU016107 1.0 ml
EUR 1394

NUP93 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV661669 1.0 ug DNA
EUR 1355

NUP93 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV661673 1.0 ug DNA
EUR 1355

NUP93 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV661674 1.0 ug DNA
EUR 1355

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Nup93 Rabbit Polyclonal Antibody