Nup93 Rabbit Polyclonal Antibody

NUP93 Polyclonal Antibody

30548-100ul 100ul
EUR 252

NUP93 Polyclonal Antibody

30548-50ul 50ul
EUR 187

NUP93 Rabbit pAb

A4333-100ul 100 ul
EUR 308

NUP93 Rabbit pAb

A4333-200ul 200 ul
EUR 459

NUP93 Rabbit pAb

A4333-20ul 20 ul
EUR 183

NUP93 Rabbit pAb

A4333-50ul 50 ul
EUR 223

NUP93 Polyclonal Conjugated Antibody

C30548 100ul
EUR 397

NUP93 Antibody

ABD4252 100 ug
EUR 438

NUP93 antibody

10R-1445 100 ug
EUR 512
Description: Mouse monoclonal NUP93 antibody

NUP93 antibody

70R-19008 50 ul
EUR 435
Description: Rabbit polyclonal NUP93 antibody

NUP93 Antibody

DF4252 200ul
EUR 304
Description: NUP93 Antibody detects endogenous levels of total NUP93.

NUP93 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

NUP93 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

NUP93 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal NUP93 Antibody (C-Term)

APR17625G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NUP93 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal NUP93 Antibody (N-Term)

APR17626G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NUP93 (N-Term). This antibody is tested and proven to work in the following applications:

Nup93/ Rat Nup93 ELISA Kit

ELI-22433r 96 Tests
EUR 886

anti- NUP93 antibody

FNab05931 100µg
EUR 548.75
  • Immunogen: nucleoporin 93kDa
  • Uniprot ID: Q8N1F7
  • Gene ID: 9688
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against NUP93

Anti-NUP93 Antibody

A07090 100ul
EUR 397
Description: Rabbit Polyclonal NUP93 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-NUP93 antibody

PAab05931 100 ug
EUR 386

Anti-Nup93 antibody

STJ94577 200 µl
EUR 197
Description: Rabbit polyclonal to Nup93.

Anti-NUP93 antibody

STJ24852 100 µl
EUR 277
Description: The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene encodes a nucleoporin protein that localizes both to the basket of the pore and to the nuclear entry of the central gated channel of the pore. The encoded protein is a target of caspase cysteine proteases that play a central role in programmed cell death by apoptosis. Alternative splicing results in multiple transcript variants encoding different isoforms.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody

abx235931-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

NUP93 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NUP93 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NUP93 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NUP93 Blocking Peptide

DF4252-BP 1mg
EUR 195

NUP93 cloning plasmid

CSB-CL822683HU-10ug 10ug
EUR 798
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2460
  • Sequence: atggatactgaggggtttggtgagctccttcagcaagctgaacagcttgctgctgagactgagggcatctcagagcttccccatgtggaacggaacttacaggagatccagcaggcgggagagcgcctgcgttcccgtaccctaacacgcacgtcccaggagacggcagatgtca
  • Show more
Description: A cloning plasmid for the NUP93 gene.

Nucleoporin 93 kDa (NUP93) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Nuclear pore complex protein Nup93, NUP93 ELISA KIT

ELI-36781h 96 Tests
EUR 824

Bovine Nuclear pore complex protein Nup93, NUP93 ELISA KIT

ELI-44229b 96 Tests
EUR 928

Mouse Nuclear pore complex protein Nup93, Nup93 ELISA KIT

ELI-44561m 96 Tests
EUR 865

Mouse NUP93 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NUP93 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF001396 96 Tests
EUR 689

Human NUP93 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NUP93 Recombinant Protein (Human)

RP021943 100 ug Ask for price

NUP93 Recombinant Protein (Rat)

RP214877 100 ug Ask for price


PVT17940 2 ug
EUR 258

NUP93 Recombinant Protein (Mouse)

RP155525 100 ug Ask for price

NUP93 ORF Vector (Human) (pORF)

ORF007315 1.0 ug DNA
EUR 95

Nup93 ORF Vector (Rat) (pORF)

ORF071627 1.0 ug DNA
EUR 506

Nup93 ORF Vector (Mouse) (pORF)

ORF051843 1.0 ug DNA
EUR 506

NUP93 sgRNA CRISPR Lentivector set (Human)

K1468601 3 x 1.0 ug
EUR 339

Nup93 sgRNA CRISPR Lentivector set (Mouse)

K4879401 3 x 1.0 ug
EUR 339

Nup93 sgRNA CRISPR Lentivector set (Rat)

K6522901 3 x 1.0 ug
EUR 339

Human Nucleoporin 93kDa(NUP93)ELISA Kit

QY-E05178 96T
EUR 361

Human Nucleoporin 93 kDa (NUP93) ELISA Kit

abx381937-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

NUP93 sgRNA CRISPR Lentivector (Human) (Target 1)

K1468602 1.0 ug DNA
EUR 154

NUP93 sgRNA CRISPR Lentivector (Human) (Target 2)

K1468603 1.0 ug DNA
EUR 154

NUP93 sgRNA CRISPR Lentivector (Human) (Target 3)

K1468604 1.0 ug DNA
EUR 154

Nup93 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4879402 1.0 ug DNA
EUR 154

Nup93 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4879403 1.0 ug DNA
EUR 154

Nup93 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4879404 1.0 ug DNA
EUR 154

Nup93 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6522902 1.0 ug DNA
EUR 154

Nup93 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6522903 1.0 ug DNA
EUR 154

Nup93 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6522904 1.0 ug DNA
EUR 154

NUP93 Protein Vector (Human) (pPB-C-His)

PV029257 500 ng
EUR 329

NUP93 Protein Vector (Human) (pPB-N-His)

PV029258 500 ng
EUR 329

NUP93 Protein Vector (Human) (pPM-C-HA)

PV029259 500 ng
EUR 329

NUP93 Protein Vector (Human) (pPM-C-His)

PV029260 500 ng
EUR 329

NUP93 Protein Vector (Mouse) (pPB-C-His)

PV207370 500 ng
EUR 1065

NUP93 Protein Vector (Mouse) (pPB-N-His)

PV207371 500 ng
EUR 1065

NUP93 Protein Vector (Mouse) (pPM-C-HA)

PV207372 500 ng
EUR 1065

NUP93 Protein Vector (Mouse) (pPM-C-His)

PV207373 500 ng
EUR 1065

NUP93 Protein Vector (Rat) (pPB-C-His)

PV286506 500 ng
EUR 1166

NUP93 Protein Vector (Rat) (pPB-N-His)

PV286507 500 ng
EUR 1166

NUP93 Protein Vector (Rat) (pPM-C-HA)

PV286508 500 ng
EUR 1166

NUP93 Protein Vector (Rat) (pPM-C-His)

PV286509 500 ng
EUR 1166

Nup93 3'UTR GFP Stable Cell Line

TU164448 1.0 ml Ask for price

NUP93 3'UTR Luciferase Stable Cell Line

TU016107 1.0 ml
EUR 1394

Nup93 3'UTR Luciferase Stable Cell Line

TU114448 1.0 ml Ask for price

NUP93 3'UTR GFP Stable Cell Line

TU066107 1.0 ml
EUR 1394

Nup93 3'UTR GFP Stable Cell Line

TU264309 1.0 ml Ask for price

Nup93 3'UTR Luciferase Stable Cell Line

TU214309 1.0 ml Ask for price

NUP93 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV661669 1.0 ug DNA
EUR 1355

NUP93 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV661673 1.0 ug DNA
EUR 1355

NUP93 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV661674 1.0 ug DNA
EUR 1355

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

Nup93 Rabbit Polyclonal Antibody