NLRX1 Rabbit Polyclonal Antibody

NLRX1 Polyclonal Antibody

ABP57527-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from NLRX1 at AA range: 581-630
  • Applications tips:
Description: A polyclonal antibody for detection of NLRX1 from Human, Mouse, Rat. This NLRX1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from NLRX1 at AA range: 581-630

NLRX1 Polyclonal Antibody

ABP57527-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from NLRX1 at AA range: 581-630
  • Applications tips:
Description: A polyclonal antibody for detection of NLRX1 from Human, Mouse, Rat. This NLRX1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from NLRX1 at AA range: 581-630

NLRX1 Polyclonal Antibody

ABP57527-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from NLRX1 at AA range: 581-630
  • Applications tips:
Description: A polyclonal antibody for detection of NLRX1 from Human, Mouse, Rat. This NLRX1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from NLRX1 at AA range: 581-630

NLRX1 Polyclonal Antibody

ES8520-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NLRX1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

NLRX1 Polyclonal Antibody

ES8520-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NLRX1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

NLRX1 Rabbit pAb

A4976-100ul 100 ul
EUR 308

NLRX1 Rabbit pAb

A4976-200ul 200 ul
EUR 459

NLRX1 Rabbit pAb

A4976-20ul 20 ul
EUR 183

NLRX1 Rabbit pAb

A4976-50ul 50 ul
EUR 223

NLRX1 Polyclonal Conjugated Antibody

C30284 100ul
EUR 397

NLRX1 Polyclonal Conjugated Antibody

C46745 100ul
EUR 397

NLRX1 antibody

70R-18898 50 ul
EUR 435
Description: Rabbit polyclonal NLRX1 antibody

NLRX1 Antibody

1-CSB-PA770306
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

NLRX1 Antibody

DF12124 200ul
EUR 304
Description: NLRX1 antibody detects endogenous levels of NLRX1.

NLRX1 Antibody

1-CSB-PA015878GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

NLRX1 Antibody

1-CSB-PA015878LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

[KO Validated] NLRX1 Polyclonal Antibody

30284-100ul 100ul
EUR 252

[KO Validated] NLRX1 Polyclonal Antibody

30284-50ul 50ul
EUR 187

Polyclonal NLRX1 Antibody (aa580-630)

APR02984G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NLRX1 (aa580-630). This antibody is tested and proven to work in the following applications:

[KO Validated] NLRX1 Rabbit pAb

A18065-100ul 100 ul
EUR 410

[KO Validated] NLRX1 Rabbit pAb

A18065-200ul 200 ul
EUR 571

[KO Validated] NLRX1 Rabbit pAb

A18065-20ul 20 ul
EUR 221

[KO Validated] NLRX1 Rabbit pAb

A18065-50ul 50 ul
EUR 287

Polyclonal NLRX1 / NOD9 Antibody (internal region)

APG00658G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NLRX1 / NOD9 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal NLRX1 Antibody - C-terminal region

APR01607G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NLRX1 - C-terminal region. This antibody is tested and proven to work in the following applications:

anti- NLRX1 antibody

FNab05759 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IHC: 1:50-1:500
  • IF: 1:10-1:100
  • Immunogen: NLR family member X1
  • Uniprot ID: Q86UT6
  • Gene ID: 79671
  • Research Area: Immunology
Description: Antibody raised against NLRX1

Anti-NLRX1 antibody

PAab05759 100 ug
EUR 355

Anti-NLRX1 antibody

STJ11100038 100 µl
EUR 413
Description: The protein encoded by this gene is a member of the NLR family and localizes to the outer mitochondrial membrane. The encoded protein is a regulator of mitochondrial antivirus responses. Three transcript variants encoding the same protein have been found for this gene.

Anti-NLRX1 antibody

STJ116270 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the NLR family and localizes to the outer mitochondrial membrane. The encoded protein is a regulator of mitochondrial antivirus responses. Three transcript variants encoding the same protein have been found for this gene.

Anti-NLRX1 antibody

STJ98633 200 µl
EUR 197
Description: Rabbit polyclonal to NLRX1.

NLRX1 siRNA

20-abx903578
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NLRX1 siRNA

20-abx926038
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NLRX1 siRNA

20-abx926039
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-NLRX1/Nod9 Antibody

A04980-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for NLRX1 Antibody (NLRX1) detection.tested for IHC, WB in Human, Mouse, Rat.

NLRX1 Antibody, HRP conjugated

1-CSB-PA015878LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NLRX1 Antibody, FITC conjugated

1-CSB-PA015878LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NLRX1 Antibody, Biotin conjugated

1-CSB-PA015878LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-NLRX1 / NOD9 antibody

STJ72177 100 µg
EUR 359

NLRX1 Blocking Peptide

DF12124-BP 1mg
EUR 195

NLRX1 cloning plasmid

CSB-CL015878HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2079
  • Sequence: atggctgctgctgggtcccacctcctctttgtgctccatggcttagagcatctcaacctcgacttccggctggcaggcacgggactttgtagtgacccggaggaaccgcaggaaccagctgctatcatcgtcaacctgctgcgcaaatacatgctgcctcaggccagcattctgg
  • Show more
Description: A cloning plasmid for the NLRX1 gene.

NLRX1 Rabbit Polyclonal Antibody