MYOZ2 Rabbit Polyclonal Antibody

MYOZ2 Polyclonal Antibody

ABP57552-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic peptide from human protein at AA range: 21-70
  • Applications tips:
Description: A polyclonal antibody for detection of MYOZ2 from Human, Mouse, Rat. This MYOZ2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 21-70

MYOZ2 Polyclonal Antibody

ABP57552-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 21-70
  • Applications tips:
Description: A polyclonal antibody for detection of MYOZ2 from Human, Mouse, Rat. This MYOZ2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 21-70

Human Myozenin 2 (MYOZ2) ELISA Kit

DLR-MYOZ2-Hu-48T 48T
EUR 517
  • Should the Human Myozenin 2 (MYOZ2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myozenin 2 (MYOZ2) in samples from tissue homogenates or other biological fluids.

Human Myozenin 2 (MYOZ2) ELISA Kit

DLR-MYOZ2-Hu-96T 96T
EUR 673
  • Should the Human Myozenin 2 (MYOZ2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myozenin 2 (MYOZ2) in samples from tissue homogenates or other biological fluids.

Human Myozenin 2 (MYOZ2) ELISA Kit

RD-MYOZ2-Hu-48Tests 48 Tests
EUR 521

Human Myozenin 2 (MYOZ2) ELISA Kit

RD-MYOZ2-Hu-96Tests 96 Tests
EUR 723

Human Myozenin 2 (MYOZ2) ELISA Kit

RDR-MYOZ2-Hu-48Tests 48 Tests
EUR 544

Human Myozenin 2 (MYOZ2) ELISA Kit

RDR-MYOZ2-Hu-96Tests 96 Tests
EUR 756

MYOZ2 Rabbit pAb

A6468-100ul 100 ul
EUR 308

MYOZ2 Rabbit pAb

A6468-200ul 200 ul
EUR 459

MYOZ2 Rabbit pAb

A6468-20ul 20 ul
EUR 183

MYOZ2 Rabbit pAb

A6468-50ul 50 ul
EUR 223

MYOZ2 antibody

38944-100ul 100ul
EUR 252

MYOZ2 Antibody

47160-100ul 100ul
EUR 252

MYOZ2 antibody

70R-18735 50 ul
EUR 435
Description: Rabbit polyclonal MYOZ2 antibody

MYOZ2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against MYOZ2. Recognizes MYOZ2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000

MYOZ2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYOZ2. Recognizes MYOZ2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IF:1:50-1:200

MYOZ2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MYOZ2. Recognizes MYOZ2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MYOZ2 Conjugated Antibody

C38944 100ul
EUR 397

Anti-MYOZ2 Antibody

A09739 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for MYOZ2 Antibody (MYOZ2) detection. Tested with WB in Human, Mouse, Rat.

Anti-MYOZ2 antibody

STJ98658 200 µl
EUR 197
Description: Rabbit polyclonal to MYOZ2.

Anti-MYOZ2 antibody

STJ28551 100 µl
EUR 277
Description: The protein encoded by this gene belongs to a family of sarcomeric proteins that bind to calcineurin, a phosphatase involved in calcium-dependent signal transduction in diverse cell types. These family members tether calcineurin to alpha-actinin at the z-line of the sarcomere of cardiac and skeletal muscle cells, and thus they are important for calcineurin signaling. Mutations in this gene cause cardiomyopathy familial hypertrophic type 16, a hereditary heart disorder.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Myozenin 2 (MYOZ2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myozenin 2 (MYOZ2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myozenin 2 (MYOZ2) Antibody

abx029523-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Myozenin 2 (MYOZ2) Antibody

abx029523-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Myozenin 2 (MYOZ2) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Myozenin 2 (MYOZ2) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Myozenin 2 (MYOZ2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myozenin 2 (MYOZ2) Antibody

abx235524-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

MYOZ2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYOZ2. Recognizes MYOZ2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MYOZ2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYOZ2. Recognizes MYOZ2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MYOZ2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYOZ2. Recognizes MYOZ2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MYOZ2 cloning plasmid

CSB-CL873609HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 795
  • Sequence: atgctatcacataatactatgatgaagcagagaaaacagcaagcaacagccatcatgaaggaagtccatggaaatgatgttgatggcatggacctgggcaaaaaggtcagcatccccagagacatcatgttggaagaattatcccatctcagtaaccgtggtgccaggctatttaa
  • Show more
Description: A cloning plasmid for the MYOZ2 gene.

MYOZ2 cloning plasmid

CSB-CL873609HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 795
  • Sequence: atgctatcacataatactatgatgaagcagagaaaacagcaagcaacagccatcatgaaggaagtccatggaaatgatgttgatggcatggacctgggcaaaaaggtcagcatccccagagacatcatgttggaagaattatcccatctcagtaaccgtggtgccaggctatttaa
  • Show more
Description: A cloning plasmid for the MYOZ2 gene.

Mouse MYOZ2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MYOZ2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MYOZ2 Recombinant Protein (Human)

RP020566 100 ug Ask for price

MYOZ2 Recombinant Protein (Human)

RP020569 100 ug Ask for price

MYOZ2 Recombinant Protein (Rat)

RP213086 100 ug Ask for price

MYOZ2 Recombinant Protein (Mouse)

RP152795 100 ug Ask for price

Human Myozenin 2 (MYOZ2) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

MYOZ2 ORF Vector (Human) (pORF)

ORF006856 1.0 ug DNA
EUR 95

MYOZ2 ORF Vector (Human) (pORF)

ORF006857 1.0 ug DNA
EUR 95

Myoz2 ORF Vector (Rat) (pORF)

ORF071030 1.0 ug DNA
EUR 506

Myoz2 ORF Vector (Mouse) (pORF)

ORF050933 1.0 ug DNA
EUR 506

Bovine Myozenin- 2, MYOZ2 ELISA KIT

ELI-13895b 96 Tests
EUR 928

Mouse Myozenin- 2, Myoz2 ELISA KIT

ELI-22826m 96 Tests
EUR 865

Human Myozenin- 2, MYOZ2 ELISA KIT

ELI-16131h 96 Tests
EUR 824

Human Myozenin 2 (MYOZ2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Myozenin 2 (MYOZ2) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

MYOZ2 sgRNA CRISPR Lentivector set (Human)

K1381401 3 x 1.0 ug
EUR 339

Myoz2 sgRNA CRISPR Lentivector set (Mouse)

K3752001 3 x 1.0 ug
EUR 339

Myoz2 sgRNA CRISPR Lentivector set (Rat)

K6311701 3 x 1.0 ug
EUR 339

Human Myozenin 2(MYOZ2)ELISA Kit

QY-E04788 96T
EUR 361

Human Myozenin 2 (MYOZ2) ELISA Kit

SEH582Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myozenin 2 (MYOZ2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myozenin 2 (MYOZ2) in Tissue homogenates and other biological fluids.

Human Myozenin 2 (MYOZ2) ELISA Kit

SEH582Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myozenin 2 (MYOZ2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myozenin 2 (MYOZ2) in Tissue homogenates and other biological fluids.

Human Myozenin 2 (MYOZ2) ELISA Kit

SEH582Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myozenin 2 (MYOZ2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myozenin 2 (MYOZ2) in Tissue homogenates and other biological fluids.

Human Myozenin 2 (MYOZ2) ELISA Kit

SEH582Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myozenin 2 (MYOZ2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myozenin 2 (MYOZ2) in Tissue homogenates and other biological fluids.

Human Myozenin 2 (MYOZ2) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Myozenin 2 elisa. Alternative names of the recognized antigen: CS-1
  • C4orf5
  • Calsarcin
  • Calcineurin Associated Sarcomeric Protein
  • FATZ-related protein 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Myozenin 2 (MYOZ2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Human MYOZ2 (Myozenin 2)

ELK4171 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Myozenin 2 (MYOZ2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Myozenin 2 (MYO
  • Show more
Description: A sandwich ELISA kit for detection of Myozenin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

MYOZ2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1381402 1.0 ug DNA
EUR 154

MYOZ2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1381403 1.0 ug DNA
EUR 154

MYOZ2 Rabbit Polyclonal Antibody