Mas1 Rabbit Polyclonal Antibody

Mas1 Polyclonal Antibody
ABP57206-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of Mas1 from Human, Mouse, Rat. This Mas1 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

Mas1 Polyclonal Antibody
ABP57206-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of Mas1 from Human, Mouse, Rat. This Mas1 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

Mas1 Polyclonal Antibody
ABP57206-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of Mas1 from Human, Mouse, Rat. This Mas1 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

MAS1 Polyclonal Antibody
A50366	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

MAS1 Rabbit pAb
A8132-100ul	Abclonal	100 ul	EUR 308

MAS1 Rabbit pAb
A8132-200ul	Abclonal	200 ul	EUR 459

MAS1 Rabbit pAb
A8132-20ul	Abclonal	20 ul	EUR 183

MAS1 Rabbit pAb
A8132-50ul	Abclonal	50 ul	EUR 223

MAS1 Oncogene (MAS1) Antibody
20-abx326994	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

MAS1 Oncogene (MAS1) Antibody
20-abx241564	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Mas1-like Polyclonal Antibody
ES4661-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Mas1-like from Human. This antibody is tested and validated for IF, WB, ELISA

Mas1-like Polyclonal Antibody
ES4661-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Mas1-like from Human. This antibody is tested and validated for IF, WB, ELISA

Mas1-like Polyclonal Antibody
ABP53662-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human Mas1-like at AA rangle: 1-80 Applications tips:
Description: A polyclonal antibody for detection of Mas1-like from Human. This Mas1-like antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Mas1-like at AA rangle: 1-80

Mas1-like Polyclonal Antibody
ABP53662-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human Mas1-like at AA rangle: 1-80 Applications tips:
Description: A polyclonal antibody for detection of Mas1-like from Human. This Mas1-like antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Mas1-like at AA rangle: 1-80

Mas1-like Polyclonal Antibody
ABP53662-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human Mas1-like at AA rangle: 1-80 Applications tips:
Description: A polyclonal antibody for detection of Mas1-like from Human. This Mas1-like antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Mas1-like at AA rangle: 1-80

MAS1 antibody
70R-7020	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal MAS1 antibody raised against the middle region of MAS1

MAS1 Antibody
36601-100ul	SAB	100ul	EUR 252

MAS1 antibody
70R-1838	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal MAS1 antibody raised against the middle region of MAS1

MAS1 Antibody
1-CSB-PA013505ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MAS1. Recognizes MAS1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MAS1 Antibody
1-CSB-PA013505LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAS1. Recognizes MAS1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

MAS1 Antibody
1-CSB-PA080177	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against MAS1. Recognizes MAS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:2000-5000.IHC:1:200-500

MAS1 Antibody
1-CSB-PA084695	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MAS1. Recognizes MAS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

Polyclonal MAS1 Antibody (C-term)
APR03929G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MAS1 (C-term). This antibody is tested and proven to work in the following applications:

MAS1 Polyclonal Antibody, HRP Conjugated
A50367	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

MAS1 Polyclonal Antibody, FITC Conjugated
A50368	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

MAS1 Polyclonal Antibody, Biotin Conjugated
A50369	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Polyclonal MAS1 / MAS Antibody (Cytoplasmic Domain)
APR01974G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MAS1 / MAS (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal MAS1 / MAS Antibody (Extracellular Domain)
APR01975G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MAS1 / MAS (Extracellular Domain). This antibody is tested and proven to work in the following applications:

Polyclonal MAS1 / MAS Antibody (C-Terminus)
APR01976G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MAS1 / MAS (C-Terminus). This antibody is tested and proven to work in the following applications:

MAS1 Conjugated Antibody
C36601	SAB	100ul	EUR 397

Anti-Mas1 Antibody
A04678	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for Mas1 Antibody (MAS1) detection. Tested with WB, IHC in Human, Mouse, Rat.

Anti-Mas1 antibody
STJ97400	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Mas1.

Anti-MAS1 antibody
STJ11100947	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a class I seven-transmembrane G-protein-coupled receptor. The encoded protein is a receptor for angiotensin-(1-7) and preferentially couples to the Gq protein, activating the phospholipase C signaling pathway. The encoded protein may play a role in multiple processes including hypotension, smooth muscle relaxation and cardioprotection by mediating the effects of angiotensin-(1-7).

Mas1/ Rat Mas1 ELISA Kit
ELI-20534r	Lifescience Market	96 Tests	EUR 886

Rat MAS1 Oncogene (MAS1) ELISA Kit
20-abx585155	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse MAS1 Oncogene (MAS1) ELISA Kit
20-abx585156	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse MAS1 Oncogene (MAS1) ELISA Kit
SEH683Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Mouse MAS1 Oncogene (MAS1) ELISA Kit
SEH683Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Mouse MAS1 Oncogene (MAS1) ELISA Kit
SEH683Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Mouse MAS1 Oncogene (MAS1) ELISA Kit
SEH683Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Mouse MAS1 Oncogene (MAS1) ELISA Kit
4-SEH683Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as MAS1 Oncogene elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse MAS1 Oncogene (MAS1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat MAS1 Oncogene (MAS1) ELISA Kit
SEH683Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Rat MAS1 Oncogene (MAS1) ELISA Kit
SEH683Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Rat MAS1 Oncogene (MAS1) ELISA Kit
SEH683Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Rat MAS1 Oncogene (MAS1) ELISA Kit
SEH683Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat MAS1 Oncogene (MAS1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat MAS1 Oncogene (MAS1) in tissue homogenates, cell lysates and other biological fluids.

Rat MAS1 Oncogene (MAS1) ELISA Kit
4-SEH683Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as MAS1 Oncogene elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat MAS1 Oncogene (MAS1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

MAS1 siRNA
20-abx903165	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MAS1 siRNA
20-abx923596	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MAS1 siRNA
20-abx923597	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MAS1 Antibody, HRP conjugated
1-CSB-PA013505LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAS1. Recognizes MAS1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MAS1 Antibody, FITC conjugated
1-CSB-PA013505LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAS1. Recognizes MAS1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MAS1 Antibody, Biotin conjugated
1-CSB-PA013505LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAS1. Recognizes MAS1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Mas1-like antibody
STJ94019	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Mas1-like.

MAS1 cloning plasmid
CSB-CL013505HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 978 Sequence: atggatgggtcaaacgtgacatcatttgttgttgaggaacccacgaacatctcaactggcaggaacgcctcagtcgggaatgcacatcggcaaatccccatcgtgcactgggtcattatgagcatctccccagtggggtttgttgagaatgggattctcctctggttcctgtgctt Show more
Description: A cloning plasmid for the MAS1 gene.

MAS1 cloning plasmid
CSB-CL013505HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 978 Sequence: ATGGATGGGTCAAACGTGACATCATTTGTTGTTGAGGAACCCACGAACATCTCAACTGGCAGGAACGCCTCAGTCGGGAATGCACATCGGCAAATCCCCATCGTGCACTGGGTCATTATGAGCATCTCCCCAGTGGGGTTTGTTGAGAATGGGATTCTCCTCTGGTTCCTGTGCTT Show more
Description: A cloning plasmid for the MAS1 gene.

MAS1 Blocking Peptide
33R-8095	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MAS1 antibody, catalog no. 70R-1838

MAS1 Blocking Peptide
33R-9598	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MAS1 antibody, catalog no. 70R-7020

Proto-Oncogene Mas (MAS1) Antibody
abx027898-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Proto-Oncogene Mas (MAS1) Antibody
abx027898-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Proto-Oncogene Mas (MAS1) Antibody
20-abx320522	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Proto-Oncogene Mas (MAS1) Antibody
20-abx318451	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Proto-Oncogene Mas (MAS1) Antibody (HRP)
20-abx304460	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Proto-Oncogene Mas (MAS1) Antibody (FITC)
20-abx304461	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Proto-Oncogene Mas (MAS1) Antibody (Biotin)
20-abx304462	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Rat MAS1 shRNA Plasmid
20-abx984822	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MAS1 ELISA KIT|Human
EF005244	Lifescience Market	96 Tests	EUR 689

Human MAS1 shRNA Plasmid
20-abx952815	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse MAS1 shRNA Plasmid
20-abx971434	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MAS1 Recombinant Protein (Human)
RP018856	ABM	100 ug	Ask for price

MAS1 Recombinant Protein (Human)
RP041251	ABM	100 ug	Ask for price

MAS1 Recombinant Protein (Rat)
RP210926	ABM	100 ug	Ask for price

MAS1 Recombinant Protein (Mouse)
RP149534	ABM	100 ug	Ask for price

MAS1 ORF Vector (Human) (pORF)
ORF006286	ABM	1.0 ug DNA	EUR 95

Mas1 ORF Vector (Mouse) (pORF)
ORF049846	ABM	1.0 ug DNA	EUR 506

MAS1 ORF Vector (Human) (pORF)
ORF013751	ABM	1.0 ug DNA	EUR 354

Mas1 ORF Vector (Rat) (pORF)
ORF070310	ABM	1.0 ug DNA	EUR 506

MAS1 sgRNA CRISPR Lentivector set (Human)
K1271601	ABM	3 x 1.0 ug	EUR 339

Mas1 sgRNA CRISPR Lentivector set (Mouse)
K3395501	ABM	3 x 1.0 ug	EUR 339

Mas1 sgRNA CRISPR Lentivector set (Rat)
K6773701	ABM	3 x 1.0 ug	EUR 339

Human Proto-oncogene Mas (MAS1) ELISA Kit
abx555483-96tests	Abbexa	96 tests	EUR 739
Shipped within 1-3 weeks.

Mouse Proto-oncogene Mas (MAS1) ELISA Kit
abx556061-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Rat Proto-oncogene Mas (MAS1) ELISA Kit
abx556208-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Human MAS1/ Proto-oncogene Mas ELISA Kit
E1551Hu	Sunlong	1 Kit	EUR 605

Mouse Proto- oncogene Mas, Mas1 ELISA KIT
ELI-13988m	Lifescience Market	96 Tests	EUR 865

Human Proto- oncogene Mas, MAS1 ELISA KIT
ELI-39661h	Lifescience Market	96 Tests	EUR 824

MAS1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1271602	ABM	1.0 ug DNA	EUR 154

MAS1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1271603	ABM	1.0 ug DNA	EUR 154

MAS1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1271604	ABM	1.0 ug DNA	EUR 154

Mas1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3395502	ABM	1.0 ug DNA	EUR 154

Mas1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3395503	ABM	1.0 ug DNA	EUR 154

Mas1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3395504	ABM	1.0 ug DNA	EUR 154

Mas1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6773702	ABM	1.0 ug DNA	EUR 154

Mas1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6773703	ABM	1.0 ug DNA	EUR 154

Mas1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6773704	ABM	1.0 ug DNA	EUR 154

MAS1 Protein Vector (Human) (pPB-C-His)
PV055001	ABM	500 ng	EUR 481

MAS1 Protein Vector (Human) (pPB-N-His)
PV055002	ABM	500 ng	EUR 481

MAS1 Protein Vector (Human) (pPM-C-HA)
PV055003	ABM	500 ng	EUR 481

MAS1 Protein Vector (Human) (pPM-C-His)
PV055004	ABM	500 ng	EUR 481

MAS1 Protein Vector (Rat) (pPB-C-His)
PV281238	ABM	500 ng	EUR 603

MAS1 Protein Vector (Rat) (pPB-N-His)
PV281239	ABM	500 ng	EUR 603

MAS1 Protein Vector (Rat) (pPM-C-HA)
PV281240	ABM	500 ng	EUR 603

MAS1 Protein Vector (Rat) (pPM-C-His)
PV281241	ABM	500 ng	EUR 603

MAS1 Protein Vector (Human) (pPB-C-His)
PV025141	ABM	500 ng	EUR 329

MAS1 Protein Vector (Human) (pPB-N-His)
PV025142	ABM	500 ng	EUR 329

MAS1 Protein Vector (Human) (pPM-C-HA)
PV025143	ABM	500 ng	EUR 329

MAS1 Protein Vector (Human) (pPM-C-His)
PV025144	ABM	500 ng	EUR 329

MAS1 Protein Vector (Mouse) (pPB-C-His)
PV199382	ABM	500 ng	EUR 603

MAS1 Protein Vector (Mouse) (pPB-N-His)
PV199383	ABM	500 ng	EUR 603

MAS1 Protein Vector (Mouse) (pPM-C-HA)
PV199384	ABM	500 ng	EUR 603

MAS1 Protein Vector (Mouse) (pPM-C-His)
PV199385	ABM	500 ng	EUR 603

Mas1 3'UTR GFP Stable Cell Line
TU162930	ABM	1.0 ml	Ask for price

Mas1 3'UTR Luciferase Stable Cell Line
TU212896	ABM	1.0 ml	Ask for price

MAS1 3'UTR Luciferase Stable Cell Line
TU013036	ABM	1.0 ml	EUR 1394

Mas1 3'UTR Luciferase Stable Cell Line
TU112930	ABM	1.0 ml	Ask for price

MAS1 3'UTR GFP Stable Cell Line
TU063036	ABM	1.0 ml	EUR 1394

Mas1 3'UTR GFP Stable Cell Line
TU262896	ABM	1.0 ml	Ask for price

MAS1 Proto-Oncogene Like, G Protein-Coupled Receptor (MAS1L) Antibody
20-abx113615	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

MAS1 Proto-Oncogene Like, G Protein-Coupled Receptor (MAS1L) Antibody
20-abx121153	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

MAS1 Proto-Oncogene Like, G Protein-Coupled Receptor (MAS1L) Antibody
20-abx322862	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

MAS1 Proto-Oncogene Like, G Protein-Coupled Receptor (MAS1L) Antibody
abx235019-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

MAS1 Proto-Oncogene Like, G Protein-Coupled Receptor (MAS1L) Antibody
20-abx302893	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody
ABP57573-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody
ABP57574-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody
ABP57575-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Gentaur Nrf2 Rabbit Polyclonal Antibody
ABP57575-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

ATG4a Rabbit Polyclonal Antibody
ABP57576-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

Mas1 Rabbit Polyclonal Antibody