LDHD Rabbit Polyclonal Antibody

LDHD Rabbit Polyclonal Conjugated Antibody
C38105 100ul
EUR 397

LDHD Polyclonal Antibody
EA126-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LDHD from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA

LDHD Polyclonal Antibody
EA126-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LDHD from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA

LDHD Polyclonal Antibody
A65962 100 µg
EUR 570.55
Description: fast delivery possible

LDHD Polyclonal Antibody
ABP57154-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of LDHD from Human, Mouse, Rat. This LDHD antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

LDHD Polyclonal Antibody
ABP57154-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of LDHD from Human, Mouse, Rat. This LDHD antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

LDHD Polyclonal Antibody
ABP57154-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of LDHD from Human, Mouse, Rat. This LDHD antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

LDHD Polyclonal Antibody
ES8153-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LDHD from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA

LDHD Polyclonal Antibody
ES8153-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LDHD from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA

Human Lactate Dehydrogenase D (LDHD) ELISA Kit
DLR-LDHD-Hu-48T 48T
EUR 517
  • Should the Human Lactate Dehydrogenase D (LDHD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lactate Dehydrogenase D (LDHD) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Lactate Dehydrogenase D (LDHD) ELISA Kit
DLR-LDHD-Hu-96T 96T
EUR 673
  • Should the Human Lactate Dehydrogenase D (LDHD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lactate Dehydrogenase D (LDHD) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Lactate Dehydrogenase D (LDHD) ELISA Kit
RDR-LDHD-Hu-48Tests 48 Tests
EUR 544

Human Lactate Dehydrogenase D (LDHD) ELISA Kit
RDR-LDHD-Hu-96Tests 96 Tests
EUR 756

Human Lactate Dehydrogenase D (LDHD) ELISA Kit
RD-LDHD-Hu-48Tests 48 Tests
EUR 521

Human Lactate Dehydrogenase D (LDHD) ELISA Kit
RD-LDHD-Hu-96Tests 96 Tests
EUR 723

LDHD Rabbit pAb
A15965-100ul 100 ul
EUR 308

LDHD Rabbit pAb
A15965-200ul 200 ul
EUR 459

LDHD Rabbit pAb
A15965-20ul 20 ul
EUR 183

LDHD Rabbit pAb
A15965-50ul 50 ul
EUR 223

LDHD Rabbit pAb
A5196-100ul 100 ul
EUR 308

LDHD Rabbit pAb
A5196-200ul 200 ul
EUR 459

LDHD Rabbit pAb
A5196-20ul 20 ul Ask for price

LDHD Rabbit pAb
A5196-50ul 50 ul Ask for price

LDHD antibody
70R-18240 50 ul
EUR 435
Description: Rabbit polyclonal LDHD antibody

LDHD Antibody
43520-100ul 100ul
EUR 252

LDHD Antibody
43877-100ul 100ul
EUR 252

LDHD Antibody
1-CSB-PA080118
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB;WB:1:1000-5000

LDHD Antibody
1-CSB-PA801250LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

LDHD antibody
70R-3502 50 ug
EUR 467
Description: Rabbit polyclonal LDHD antibody raised against the middle region of LDHD

LDHD Antibody
1-CSB-PA012845GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

Polyclonal LDHD Antibody (N-term)
APR05672G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LDHD (N-term). This antibody is tested and proven to work in the following applications:

LDHD Polyclonal Antibody, HRP Conjugated
A65963 100 µg
EUR 570.55
Description: reagents widely cited

LDHD Polyclonal Antibody, FITC Conjugated
A65964 100 µg
EUR 570.55
Description: Ask the seller for details

LDHD Polyclonal Antibody, Biotin Conjugated
A65965 100 µg
EUR 570.55
Description: The best epigenetics products

LDHD Conjugated Antibody
C43520 100ul
EUR 397

LDHD Conjugated Antibody
C43877 100ul
EUR 397

anti- LDHD antibody
FNab04741 100µg
EUR 548.75
  • Immunogen: lactate dehydrogenase D
  • Uniprot ID: Q86WU2
  • Gene ID: 197257
  • Research Area: Metabolism
Description: Antibody raised against LDHD

Anti-LDHD antibody
PAab04741 100 ug
EUR 386

Anti-LDHD antibody
STJ111240 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the D-isomer specific 2-hydroxyacid dehydrogenase family. The similar protein in yeast has both D-lactate and D-glycerate dehydrogenase activities. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified.

Anti-LDHD antibody
STJ118424 100 µl
EUR 277

Anti-LDHD antibody
STJ97199 200 µl
EUR 197
Description: Rabbit polyclonal to LDHD.

Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human)
4-PAE130Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHD (Arg62~Ala265)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD)

LDHD siRNA
20-abx922391
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LDHD siRNA
20-abx922392
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-LDHD
YF-PA22659 50 ug
EUR 363
Description: Mouse polyclonal to LDHD

anti-LDHD
YF-PA22660 100 ug
EUR 403
Description: Rabbit polyclonal to LDHD

LDHD Antibody, HRP conjugated
1-CSB-PA801250LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LDHD Antibody, FITC conjugated
1-CSB-PA801250LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LDHD Antibody, Biotin conjugated
1-CSB-PA801250LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human), APC
4-PAE130Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHD (Arg62~Ala265)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD). This antibody is labeled with APC.

Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human), Biotinylated
4-PAE130Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHD (Arg62~Ala265)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD). This antibody is labeled with Biotin.

Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human), Cy3
4-PAE130Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHD (Arg62~Ala265)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD). This antibody is labeled with Cy3.

Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human), FITC
4-PAE130Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHD (Arg62~Ala265)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD). This antibody is labeled with FITC.

Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human), HRP
4-PAE130Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHD (Arg62~Ala265)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD). This antibody is labeled with HRP.

Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human), PE
4-PAE130Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHD (Arg62~Ala265)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD). This antibody is labeled with PE.

Rabbit Lactate Dehydrogenase D (LDHD) ELISA Kit
abx362813-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

LDHD Blocking Peptide
33R-5196 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LDHD antibody, catalog no. 70R-3502

LDHD cloning plasmid
CSB-CL801250HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1524
  • Sequence: atggcccgactgctcaggtctgcaacctgggagctgttcccctggaggggctactgctcccagaaggcaaagggagagctctgcagggacttcgtagaggctctgaaggccgtggtgggcggctcccacgtgtccactgccgcggtggtccgagagcagcacgggcgcgatgagt
  • Show more
Description: A cloning plasmid for the LDHD gene.

Lactate Dehydrogenase D (LDHD) Antibody
20-abx113429
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody
20-abx126961
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody
20-abx128330
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lactate Dehydrogenase D (LDHD) Antibody
20-abx134538
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody
abx145634-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody
20-abx173292
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Lactate Dehydrogenase D (LDHD) Antibody
abx032602-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody
abx032602-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody
abx234741-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Lactate Dehydrogenase D (LDHD) Antibody
20-abx326977
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody
20-abx318606
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human), APC-Cy7
4-PAE130Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHD (Arg62~Ala265)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD). This antibody is labeled with APC-Cy7.

Lactate Dehydrogenase D (LDHD) Antibody (HRP)
20-abx308426
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody (FITC)
20-abx308427
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody (Biotin)
20-abx308428
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human LDHD ELISA Kit
ELA-E1698h 96 Tests
EUR 824

LDHD ELISA KIT|Human
EF009653 96 Tests
EUR 689

Human LDHD shRNA Plasmid
20-abx966195
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse LDHD shRNA Plasmid
20-abx974287
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LDHD Recombinant Protein (Human)
RP017650 100 ug Ask for price

LDHD Recombinant Protein (Rat)
RP207959 100 ug Ask for price

LDHD Recombinant Protein (Mouse)
RP147164 100 ug Ask for price

Rat LDHD ELISA Kit
STJ150057 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of D-LDH in Rat serum, plasma and other biological fluids

Ldhd ORF Vector (Rat) (pORF)
ORF069321 1.0 ug DNA
EUR 506

LDHD ORF Vector (Human) (pORF)
ORF005884 1.0 ug DNA
EUR 95

Ldhd ORF Vector (Mouse) (pORF)
ORF049056 1.0 ug DNA
EUR 506

Recombinant Lactate Dehydrogenase D (LDHD)
4-RPE130Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q86WU2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 51.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Lactate Dehydrogenase D expressed in: E.coli

Human Lactate Dehydrogenase D (LDHD) Protein
20-abx168150
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ldhd sgRNA CRISPR Lentivector set (Rat)
K6101501 3 x 1.0 ug
EUR 339

Ldhd sgRNA CRISPR Lentivector set (Mouse)
K3138201 3 x 1.0 ug
EUR 339

LDHD sgRNA CRISPR Lentivector set (Human)
K1205801 3 x 1.0 ug
EUR 339

Human Lactate Dehydrogenase D (LDHD) ELISA Kit
abx053234-96tests 96 tests
EUR 754
  • Shipped within 5-10 working days.

Human Lactate Dehydrogenase D (LDHD) ELISA Kit
20-abx152182
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Lactate Dehydrogenase D (LDHD) ELISA Kit
abx255322-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Lactate Dehydrogenase D (LDHD) ELISA Kit
abx256875-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Sheep Lactate Dehydrogenase D (LDHD) ELISA Kit
abx257102-96tests 96 tests
EUR 864
  • Shipped within 5-12 working days.

Human Lactate Dehydrogenase D (LDHD) ELISA Kit
abx252339-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Monkey Lactate Dehydrogenase D (LDHD) ELISA Kit
abx359717-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Pig Lactate Dehydrogenase D (LDHD) ELISA Kit
abx361256-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Chicken Lactate Dehydrogenase D (LDHD) ELISA Kit
abx356517-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Lactate Dehydrogenase D (LDHD) CLIA Kit
20-abx494510
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Ldhd sgRNA CRISPR Lentivector (Rat) (Target 1)
K6101502 1.0 ug DNA
EUR 154

Ldhd sgRNA CRISPR Lentivector (Rat) (Target 2)
K6101503 1.0 ug DNA
EUR 154

Ldhd sgRNA CRISPR Lentivector (Rat) (Target 3)
K6101504 1.0 ug DNA
EUR 154

Ldhd sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3138202 1.0 ug DNA
EUR 154

Ldhd sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3138203 1.0 ug DNA
EUR 154

Ldhd sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3138204 1.0 ug DNA
EUR 154

LDHD sgRNA CRISPR Lentivector (Human) (Target 1)
K1205802 1.0 ug DNA
EUR 154

LDHD sgRNA CRISPR Lentivector (Human) (Target 2)
K1205803 1.0 ug DNA
EUR 154

LDHD sgRNA CRISPR Lentivector (Human) (Target 3)
K1205804 1.0 ug DNA
EUR 154

LDHD Protein Vector (Human) (pPB-C-His)
PV023533 500 ng
EUR 329

LDHD Protein Vector (Human) (pPB-N-His)
PV023534 500 ng
EUR 329

LDHD Protein Vector (Human) (pPM-C-HA)
PV023535 500 ng
EUR 329

LDHD Protein Vector (Human) (pPM-C-His)
PV023536 500 ng
EUR 329

LDHD Protein Vector (Rat) (pPB-C-His)
PV277282 500 ng
EUR 603

LDHD Protein Vector (Rat) (pPB-N-His)
PV277283 500 ng
EUR 603

LDHD Protein Vector (Rat) (pPM-C-HA)
PV277284 500 ng
EUR 603

LDHD Protein Vector (Rat) (pPM-C-His)
PV277285 500 ng
EUR 603

LDHD Protein Vector (Mouse) (pPB-C-His)
PV196222 500 ng
EUR 603

LDHD Protein Vector (Mouse) (pPB-N-His)
PV196223 500 ng
EUR 603

LDHD Protein Vector (Mouse) (pPM-C-HA)
PV196224 500 ng
EUR 603

LDHD Protein Vector (Mouse) (pPM-C-His)
PV196225 500 ng
EUR 603

Human Lactate Dehydrogenase D (LDHD) ELISA Kit
SEE130Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lactate Dehydrogenase D (LDHD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lactate Dehydrogenase D (LDHD) in Tissue homogenates, cell lysates and other biological fluids.

Human Lactate Dehydrogenase D (LDHD) ELISA Kit
SEE130Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lactate Dehydrogenase D (LDHD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lactate Dehydrogenase D (LDHD) in Tissue homogenates, cell lysates and other biological fluids.

Human Lactate Dehydrogenase D (LDHD) ELISA Kit
SEE130Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lactate Dehydrogenase D (LDHD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lactate Dehydrogenase D (LDHD) in Tissue homogenates, cell lysates and other biological fluids.

Human Lactate Dehydrogenase D (LDHD) ELISA Kit
SEE130Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lactate Dehydrogenase D (LDHD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lactate Dehydrogenase D (LDHD) in Tissue homogenates, cell lysates and other biological fluids.

Human Lactate Dehydrogenase D (LDHD) ELISA Kit
4-SEE130Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Lactate Dehydrogenase D elisa. Alternative names of the recognized antigen: LDH-D
  • DLD
  • Probable D-lactate dehydrogenase, mitochondrial
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Lactate Dehydrogenase D (LDHD) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Ldhd 3'UTR Luciferase Stable Cell Line
TU110977 1.0 ml Ask for price

Ldhd 3'UTR GFP Stable Cell Line
TU160977 1.0 ml Ask for price

Ldhd 3'UTR Luciferase Stable Cell Line
TU206998 1.0 ml Ask for price

Ldhd 3'UTR GFP Stable Cell Line
TU256998 1.0 ml Ask for price

LDHD 3'UTR GFP Stable Cell Line
TU062362 1.0 ml
EUR 1394

LDHD 3'UTR Luciferase Stable Cell Line
TU012362 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

LDHD Rabbit Polyclonal Antibody