KCNN2 (SK2) Rabbit Polyclonal Antibody

KCNN2 (SK2) Polyclonal Antibody

ABP57336-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of KCNN2 SK2) from Human, Mouse, Rat. This KCNN2 SK2) antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

KCNN2 (SK2) Polyclonal Antibody

ABP57336-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of KCNN2 SK2) from Human, Mouse, Rat. This KCNN2 SK2) antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

KCNN2 (SK2) Polyclonal Antibody

ABP57336-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of KCNN2 SK2) from Human, Mouse, Rat. This KCNN2 SK2) antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

Anti-KCNN2 (SK2) antibody

STJ97583 200 µl
EUR 197
Description: Rabbit polyclonal to KCNN2 (SK2) (A244).

Polyclonal KCa2.2 (SK2) Antibody

AMM06063G 0.05ml
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCa2.2 (SK2) . This antibody is tested and proven to work in the following applications:

SK2 Antibody

abx016183-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

SK2 Antibody

48406-100ul 100ul
EUR 333

SK2 Antibody

48406-50ul 50ul
EUR 239

SK2 Conjugated Antibody

C48406 100ul
EUR 397

KCNN2 Rabbit pAb

A10662-100ul 100 ul
EUR 308

KCNN2 Rabbit pAb

A10662-200ul 200 ul
EUR 459

KCNN2 Rabbit pAb

A10662-20ul 20 ul
EUR 183

KCNN2 Rabbit pAb

A10662-50ul 50 ul
EUR 223

Polyclonal KCNN2 Antibody (Internal)

AMM06144G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human KCNN2 (Internal). This antibody is tested and proven to work in the following applications:

KCNN2 Antibody

20-abx326931
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

KCNN2 antibody

70R-5106 50 ug
EUR 467
Description: Rabbit polyclonal KCNN2 antibody raised against the middle region of KCNN2

KCNN2 Antibody

47688-100ul 100ul
EUR 252

KCNN2 antibody

70R-1495 100 ug
EUR 377
Description: Rabbit polyclonal KCNN2 antibody raised against the C terminal of KCNN2

KCNN2 Antibody

1-CSB-PA285157
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against KCNN2. Recognizes KCNN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB.IHC, ELISA;WB:1:1000-2000, IHC-p:1:100-200

Polyclonal KCNN2 Antibody (C-Terminus)

AMM06143G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNN2 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal KCNN2 antibody - middle region

AMM06146G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNN2 - middle region. This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-KCNN2 Antibody

APR12123G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-KCNN2 . This antibody is tested and proven to work in the following applications:

Monoclonal SK2 Antibody, Clone: 9C5E1

APR09989G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human SK2. The antibodies are raised in Mouse and are from clone 9C5E1. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal SK2 Antibody, Clone: 3C8D3

APR09990G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human SK2. The antibodies are raised in Mouse and are from clone 3C8D3. This antibody is applicable in WB and IHC, FC, ICC, E

Polyclonal KCNN2 antibody - C-terminal region

AMM06145G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNN2 - C-terminal region. This antibody is tested and proven to work in the following applications:

Kcnn2/ Rat Kcnn2 ELISA Kit

ELI-28089r 96 Tests
EUR 886

KCNN2 Conjugated Antibody

C47688 100ul
EUR 397

Anti-KCNN2 antibody

STJ72049 100 µg
EUR 359

Anti-KCNN2 antibody

STJ118018 100 µl
EUR 277
Description: Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. The protein encoded by this gene is activated before membrane hyperpolarization and is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene is a member of the KCNN family of potassium channel genes. The encoded protein is an integral membrane protein that forms a voltage-independent calcium-activated channel with three other calmodulin-binding subunits. Alternate splicing of this gene results in multiple transcript variants.

Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit

DLR-KCNN2-Hu-48T 48T
EUR 554
  • Should the Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit

DLR-KCNN2-Hu-96T 96T
EUR 725
  • Should the Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit

RD-KCNN2-Hu-48Tests 48 Tests
EUR 563

Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit

RD-KCNN2-Hu-96Tests 96 Tests
EUR 783

Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit

RDR-KCNN2-Hu-48Tests 48 Tests
EUR 589

Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit

RDR-KCNN2-Hu-96Tests 96 Tests
EUR 820

Mating Factor a­-SK2

H-4580.0001 1.0mg
EUR 441
Description: Sum Formula: C81H106N18O19S; CAS# [89718-47-8]

Mating Factor a­-SK2

H-4580.0005 5.0mg
EUR 1675
Description: Sum Formula: C81H106N18O19S; CAS# [89718-47-8]

KCNN2 siRNA

20-abx902816
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KCNN2 siRNA

20-abx921298
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KCNN2 siRNA

20-abx921299
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KCNN2 Blocking Peptide

33R-3914 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNN2 antibody, catalog no. 70R-1495

KCNN2 Blocking Peptide

33R-4564 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNN2 antibody, catalog no. 70R-5106

KCNN2 cloning plasmid

CSB-CL880957HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 696
  • Sequence: atgtggttgatatcaataacttttctctccattggttatggtgacatggtacctaacacatactgtggaaaaggagtctgcttacttactggaattatgggtgctggttgcacagccctggtggtagctgtagtggcaaggaagctagaacttaccaaagcagaaaaacacgtgca
  • Show more
Description: A cloning plasmid for the KCNN2 gene.

KCNN2 cloning plasmid

CSB-CL880957HU2-10ug 10ug
EUR 597
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1740
  • Sequence: atgagcagctgcaggtacaacgggggcgtcatgcggccgctcagcaacttgagcgcgtcccgccggaacctgcacgagatggactcagaggcgcagcccctgcagccccccgcgtctgtcggaggaggtggcggcgcgtcctccccgtctgcagccgctgccgccgccgccgctg
  • Show more
Description: A cloning plasmid for the KCNN2 gene.

Mouse KCNN2 shRNA Plasmid

20-abx980248
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat KCNN2 shRNA Plasmid

20-abx985805
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Kcnn2 ELISA KIT

ELI-12837m 96 Tests
EUR 865

Human KCNN2 ELISA KIT

ELI-08084h 96 Tests
EUR 824

Human KCNN2 shRNA Plasmid

20-abx952555
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

KCNN2 Recombinant Protein (Human)

RP016660 100 ug Ask for price

KCNN2 Recombinant Protein (Human)

RP040261 100 ug Ask for price

KCNN2 Recombinant Protein (Rat)

RP206930 100 ug Ask for price

KCNN2 Recombinant Protein (Mouse)

RP145304 100 ug Ask for price

KCNN2 ORF Vector (Human) (pORF)

ORF005554 1.0 ug DNA
EUR 95

Kcnn2 ORF Vector (Rat) (pORF)

ORF068978 1.0 ug DNA
EUR 506

Kcnn2 ORF Vector (Mouse) (pORF)

ORF048436 1.0 ug DNA
EUR 506

KCNN2 ORF Vector (Human) (pORF)

ORF013421 1.0 ug DNA
EUR 354

Small Conductance Calcium-Activated Potassium Channel Protein 2 (SK2) Antibody

abx224215-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

KCNN2 sgRNA CRISPR Lentivector set (Human)

K1124201 3 x 1.0 ug
EUR 339

Kcnn2 sgRNA CRISPR Lentivector set (Mouse)

K4357101 3 x 1.0 ug
EUR 339

Kcnn2 sgRNA CRISPR Lentivector set (Rat)

K6854501 3 x 1.0 ug
EUR 339

KCNN2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1124202 1.0 ug DNA
EUR 154

KCNN2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1124203 1.0 ug DNA
EUR 154

KCNN2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1124204 1.0 ug DNA
EUR 154

Kcnn2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4357102 1.0 ug DNA
EUR 154

Kcnn2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4357103 1.0 ug DNA
EUR 154

Kcnn2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4357104 1.0 ug DNA
EUR 154

Kcnn2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6854502 1.0 ug DNA
EUR 154

Kcnn2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6854503 1.0 ug DNA
EUR 154

Kcnn2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6854504 1.0 ug DNA
EUR 154

KCNN2 Protein Vector (Human) (pPB-C-His)

PV053681 500 ng
EUR 481

KCNN2 Protein Vector (Human) (pPB-N-His)

PV053682 500 ng
EUR 481

KCNN2 Protein Vector (Human) (pPM-C-HA)

PV053683 500 ng
EUR 481

KCNN2 Protein Vector (Human) (pPM-C-His)

PV053684 500 ng
EUR 481

KCNN2 Protein Vector (Human) (pPB-C-His)

PV022213 500 ng
EUR 329

KCNN2 Protein Vector (Human) (pPB-N-His)

PV022214 500 ng
EUR 329

KCNN2 Protein Vector (Human) (pPM-C-HA)

PV022215 500 ng
EUR 329

KCNN2 Protein Vector (Human) (pPM-C-His)

PV022216 500 ng
EUR 329

KCNN2 Protein Vector (Rat) (pPB-C-His)

PV275910 500 ng
EUR 603

KCNN2 Protein Vector (Rat) (pPB-N-His)

PV275911 500 ng
EUR 603

KCNN2 Protein Vector (Rat) (pPM-C-HA)

PV275912 500 ng
EUR 603

KCNN2 Protein Vector (Rat) (pPM-C-His)

PV275913 500 ng
EUR 603

KCNN2 Protein Vector (Mouse) (pPB-C-His)

PV193742 500 ng
EUR 603

KCNN2 Protein Vector (Mouse) (pPB-N-His)

PV193743 500 ng
EUR 603

KCNN2 Protein Vector (Mouse) (pPM-C-HA)

PV193744 500 ng
EUR 603

KCNN2 Protein Vector (Mouse) (pPM-C-His)

PV193745 500 ng
EUR 603

Kcnn2 3'UTR Luciferase Stable Cell Line

TU206610 1.0 ml Ask for price

Kcnn2 3'UTR GFP Stable Cell Line

TU160465 1.0 ml Ask for price

KCNN2 3'UTR Luciferase Stable Cell Line

TU011535 1.0 ml
EUR 1394

Kcnn2 3'UTR Luciferase Stable Cell Line

TU110465 1.0 ml Ask for price

KCNN2 3'UTR GFP Stable Cell Line

TU061535 1.0 ml
EUR 1394

Kcnn2 3'UTR GFP Stable Cell Line

TU256610 1.0 ml Ask for price

KCNN2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV685939 1.0 ug DNA
EUR 682

KCNN2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV685943 1.0 ug DNA
EUR 682

KCNN2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV685944 1.0 ug DNA
EUR 682

KCNN2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV701817 1.0 ug DNA
EUR 450

KCNN2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV701821 1.0 ug DNA
EUR 450

KCNN2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV701822 1.0 ug DNA
EUR 450

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

KCNN2 (SK2) Rabbit Polyclonal Antibody