Imp3 Rabbit Polyclonal Antibody

Imp3 Polyclonal Antibody

46748-100ul 100ul
EUR 252

Imp3 Polyclonal Antibody

46748-50ul 50ul
EUR 187

IMP3 Rabbit pAb

A8855-100ul 100 ul
EUR 308

IMP3 Rabbit pAb

A8855-200ul 200 ul
EUR 459

IMP3 Rabbit pAb

A8855-20ul 20 ul
EUR 183

IMP3 Rabbit pAb

A8855-50ul 50 ul
EUR 223

Imp3 Polyclonal Conjugated Antibody

C46748 100ul
EUR 397

IMP3 antibody

70R-4709 50 ug
EUR 467
Description: Rabbit polyclonal IMP3 antibody

IMP3 antibody

70R-17963 50 ul
EUR 435
Description: Rabbit polyclonal IMP3 antibody

IMP3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IMP3. Recognizes IMP3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

IMP3 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against IMP3. Recognizes IMP3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000

Monoclonal IMP3 Antibody

AMM03180G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human IMP3. The antibodies are raised in Mouse. This antibody is applicable in WB

anti- IMP3 antibody

FNab04296 100µg
EUR 505.25
  • Immunogen: IMP3, U3 small nucleolar ribonucleoprotein, homolog(yeast)
  • Uniprot ID: Q9NV31
  • Gene ID: 55272
  • Research Area: Immunology, Metabolism
Description: Antibody raised against IMP3

anti- IMP3 antibody

FNab04297 100µg
EUR 585
  • Recommended dilution: WB: 1:1000-1:4000
  • IHC: 1:50-1:500
  • IF: 1:20-1:200
  • Immunogen: IMP3, U3 small nucleolar ribonucleoprotein, homolog(yeast)
  • Uniprot ID: Q9NV31
  • Gene ID: 55272
  • Research Area: Immunology, Metabolism
Description: Antibody raised against IMP3

Human IMP3 Antibody

33429-05111 150 ug
EUR 261

IMP3 Monoclonal Antibody

27206-100ul 100ul
EUR 252

IMP3 Monoclonal Antibody

27206-50ul 50ul
EUR 187

Anti-IMP3 antibody

PAab04296 100 ug
EUR 355

Anti-IMP3 antibody

STJ72288 100 µg
EUR 359

Anti-Imp3 antibody

STJ98644 200 µl
EUR 197
Description: Rabbit polyclonal to Imp3.

Anti-IMP3 antibody

STJ99190 200 µl
EUR 197
Description: Mouse monoclonal to IMP3.

Anti-IMP3 antibody

STJ111453 100 µl
EUR 277
Description: This gene encodes the human homolog of the yeast Imp3 protein. The protein localizes to the nucleoli and interacts with the U3 snoRNP complex. The protein contains an S4 domain.

U3 Small Nucleolar Ribonucleoprotein Protein IMP3 (IMP3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

U3 Small Nucleolar Ribonucleoprotein Protein IMP3 (Imp3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

U3 Small Nucleolar Ribonucleoprotein Protein IMP3 (IMP3) Antibody

abx034563-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

U3 Small Nucleolar Ribonucleoprotein Protein IMP3 (IMP3) Antibody

abx034563-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

U3 Small Nucleolar Ribonucleoprotein Protein IMP3 (IMP3) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

U3 Small Nucleolar Ribonucleoprotein Protein IMP3 (IMP3) Antibody

abx431005-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

U3 Small Nucleolar Ribonucleoprotein Protein IMP3 (IMP3) Antibody

abx234296-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

U3 Small Nucleolar Ribonucleoprotein Protein IMP3 (IMP3) Antibody

abx234297-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IMP3 Conjugated Monoclonal Antibody

C27206 100ul
EUR 397

Anti-IMP3 Monoclonal Antibody

M02362-1 100ug
EUR 397
Description: Rabbit Monoclonal IMP3 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

U3 Small Nucleolar Ribonucleoprotein Protein IMP3 (IMP3) Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

IMP3 Blocking Peptide

33R-3318 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of IMP3 antibody, catalog no. 70R-4709

IMP3 cloning plasmid

CSB-CL873661HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 555
  • Sequence: atggtgcggaagcttaagttccacgagcagaagctgctgaagcaggtggacttcctgaactgggaggtcaccgaccacaacctgcacgagctgcgcgtgctgcggcgttaccggctgcagcggcgggaggactacacgcgctacaaccagctgagccgtgccgtgcgtgagctggc
  • Show more
Description: A cloning plasmid for the IMP3 gene.

IMP3 cloning plasmid

CSB-CL873661HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 555
  • Sequence: atggtgcggaagcttaagttccacgagcagaagctgctgaagcaggtggacttcctgaactgggaggtcaccgaccacaacctgcacgagctgcgcgtgctgcggcgttaccggctgcagcggcgggaggactacacgcgctacaaccagctgagccgtgccgtgcgtgagctggc
  • Show more
Description: A cloning plasmid for the IMP3 gene.


PVT13284 2 ug
EUR 391

Human IMP3 Antibody (Biotin Conjugate)

33429-05121 150 ug
EUR 369

Human U3 Small Nucleolar Ribonucleoprotein Protein IMP3 (IMP3) ELISA Kit

abx387975-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human U3 small nucleolar ribonucleoprotein protein IMP3(IMP3) ELISA kit

CSB-EL011692HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human U3 small nucleolar ribonucleoprotein protein IMP3 (IMP3) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human U3 small nucleolar ribonucleoprotein protein IMP3(IMP3) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human U3 small nucleolar ribonucleoprotein protein IMP3(IMP3) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse IMP3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Imp3 ELISA KIT

ELI-13398m 96 Tests
EUR 865


ELI-21460h 96 Tests
EUR 824


ELI-08230b 96 Tests
EUR 928


EF010328 96 Tests
EUR 689

IMP3 protein (His tag)

80R-2624 100 ug
EUR 322
Description: Purified recombinant Human IMP3 protein (His tag)

Human IMP3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

IMP3 Human Recombinant Protein

PROTQ9NV31 Regular: 20ug
EUR 317
Description: IMP3 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 207 amino acids (1-184 a.a) and having a molecular mass of 24kDa. IMP3 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Imp3 Rabbit Polyclonal Antibody