IGFN1 Rabbit Polyclonal Antibody

IGFN1 Polyclonal Antibody
ABP57224-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of IGFN1 from Human, Mouse, Rat. This IGFN1 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

IGFN1 Antibody
1-CSB-PA080195
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against IGFN1. Recognizes IGFN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:2000-5000.IHC:1:200-500

IGFN1 Antibody
1-CSB-PA080268
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against IGFN1. Recognizes IGFN1 from Human, Mouse, Rat, Pg. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:500-1:2000.IHC:1:50-1:200

Anti-IGFN1 antibody
STJ97418 200 µl
EUR 197
Description: Rabbit polyclonal to IGFN1.

IGFN1 siRNA
20-abx920330
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IGFN1 siRNA
20-abx920331
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IGFN1 cloning plasmid
CSB-CL769786HU-10ug 10ug
EUR 839
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2607
  • Sequence: ATGGGGTGGCAGCCTATGGGAGAGAACTGGGGGTGCCTGGAGGAGATGCTGAATGAAGATCAGAGCCGGGAGCCCCCTGGTCACCTTGGTAGCAGGAGAAGTGGCAAAGACGGCAGGTTGGACATCTATGGAGAGAGGAGAGATGCTACCCGGAGTTCCACATCCAGATACAAGC
  • Show more
Description: A cloning plasmid for the IGFN1 gene.

Mouse IGFN1 shRNA Plasmid
20-abx981490
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human IGFN1 shRNA Plasmid
20-abx964016
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Igfn1 ELISA KIT
ELI-13407m 96 Tests
EUR 865

Human IGFN1 ELISA KIT
ELI-08308h 96 Tests
EUR 824

IGFN1 ELISA KIT|Human
EF005124 96 Tests
EUR 689

Igfn1 ORF Vector (Mouse) (pORF)
ORF047747 1.0 ug DNA
EUR 3087

IGFN1 ORF Vector (Human) (pORF)
ORF021411 1.0 ug DNA
EUR 405

IGFN1 sgRNA CRISPR Lentivector set (Human)
K1026701 3 x 1.0 ug
EUR 339

Igfn1 sgRNA CRISPR Lentivector set (Mouse)
K4234401 3 x 1.0 ug
EUR 339

IGFN1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1026702 1.0 ug DNA
EUR 154

IGFN1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1026703 1.0 ug DNA
EUR 154

IGFN1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1026704 1.0 ug DNA
EUR 154

Igfn1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4234402 1.0 ug DNA
EUR 154

Igfn1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4234403 1.0 ug DNA
EUR 154

IGFN1 Rabbit Polyclonal Antibody