FXR2 Rabbit Polyclonal Antibody

FXR2 Polyclonal Antibody

ES8049-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FXR2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

FXR2 Rabbit pAb

A14092-100ul 100 ul
EUR 308

FXR2 Rabbit pAb

A14092-200ul 200 ul
EUR 459

FXR2 Rabbit pAb

A14092-20ul 20 ul
EUR 183

FXR2 Rabbit pAb

A14092-50ul 50 ul
EUR 223

FXR2 Rabbit pAb

A4313-100ul 100 ul
EUR 308

FXR2 Rabbit pAb

A4313-200ul 200 ul
EUR 459

FXR2 Rabbit pAb

A4313-20ul 20 ul
EUR 183

FXR2 Rabbit pAb

A4313-50ul 50 ul
EUR 223

FXR2 antibody

70R-17374 50 ul
EUR 435
Description: Rabbit polyclonal FXR2 antibody

FXR2 antibody

70R-31745 100 ug
EUR 327
Description: Rabbit polyclonal FXR2 antibody

FXR2 Antibody

33793-100ul 100ul
EUR 252

FXR2 Antibody

33793-50ul 50ul
EUR 187

FXR2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FXR2. Recognizes FXR2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

FXR2 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FXR2. Recognizes FXR2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

FXR2 Antibody

CSB-PA870516-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FXR2. Recognizes FXR2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

FXR2 Antibody

DF3195 200ul
EUR 304
Description: FXR2 Antibody detects endogenous levels of total FXR2.

FXR2 antibody

70R-4723 50 ug
EUR 467
Description: Rabbit polyclonal FXR2 antibody raised against the middle region of FXR2

FXR2 antibody

70R-50717 100 ul
EUR 244
Description: Purified Polyclonal FXR2 antibody

FXR2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FXR2. Recognizes FXR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FXR2 Antibody

ABD3195 100 ug
EUR 438

FXR2 Conjugated Antibody

C33793 100ul
EUR 397

anti- FXR2 antibody

FNab03257 100µg
EUR 505.25
  • Immunogen: fragile X mental retardation, autosomal homolog 2
  • Uniprot ID: P51116
  • Gene ID: 9513
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against FXR2

Anti-FXR2 antibody

PAab03257 100 ug
EUR 355

Anti-FXR2 antibody

STJ116027 100 µl
EUR 277
Description: The protein encoded by this gene is a RNA binding protein containing two KH domains and one RCG box, which is similar to FMRP and FXR1. It associates with polyribosomes, predominantly with 60S large ribosomal subunits. This encoded protein may self-associate or interact with FMRP and FXR1. It may have a role in the development of fragile X mental retardation syndrome.

Anti-FXR2 antibody

STJ23723 100 µl
EUR 277
Description: The protein encoded by this gene is a RNA binding protein containing two KH domains and one RCG box, which is similar to FMRP and FXR1. It associates with polyribosomes, predominantly with 60S large ribosomal subunits. This encoded protein may self-associate or interact with FMRP and FXR1. It may have a role in the development of fragile X mental retardation syndrome.

Anti-FXR2 antibody

STJ93168 200 µl
EUR 197
Description: Rabbit polyclonal to FXR2.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT10262 2 ug
EUR 301


YF-PA16355 50 ul
EUR 363
Description: Mouse polyclonal to FXR2


YF-PA16356 50 ug
EUR 363
Description: Mouse polyclonal to FXR2


YF-PA16357 100 ug
EUR 403
Description: Rabbit polyclonal to FXR2

FXR2 Blocking Peptide

33R-7935 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FXR2 antibody, catalog no. 70R-4723

FXR2 Blocking Peptide

DF3195-BP 1mg
EUR 195

FXR2 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

FXR2 cloning plasmid

CSB-CL009088HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2022
  • Sequence: atgggcggcctggcctctgggggggatgtggagccgggactgcccgtcgaggtgcgcggctccaacggggccttctacaagggctttgtgaaggatgtccatgaagactctgtcaccatcttctttgaaaacaactggcagagtgagagacaaattccttttggggatgtccggc
  • Show more
Description: A cloning plasmid for the FXR2 gene.

FXR2 cloning plasmid

CSB-CL009088HU2-10ug 10ug
EUR 675
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2022
  • Sequence: atgggcggcctggcctctgggggggatgtggagccgggactgcccgtcgaggtgcgcggctccaacggggccttctacaagggctttgtgaaggatgtccatgaagactctgtcaccatcttctttgaaaacaactggcagagtgagagacaaattccttttggggatgtccggc
  • Show more
Description: A cloning plasmid for the FXR2 gene.


ELI-30809h 96 Tests
EUR 824

Mouse Fxr2 ELISA KIT

ELI-30810m 96 Tests
EUR 865


EF009720 96 Tests
EUR 689

Human FXR2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FXR2 Recombinant Protein (Human)

RP012688 100 ug Ask for price

FXR2 Recombinant Protein (Human)

RP012691 100 ug Ask for price

FXR2 Recombinant Protein (Rat)

RP201920 100 ug Ask for price

FXR2 Recombinant Protein (Mouse)

RP135473 100 ug Ask for price

Fxr2 ORF Vector (Rat) (pORF)

ORF067308 1.0 ug DNA
EUR 506

FXR2 ORF Vector (Human) (pORF)

ORF004230 1.0 ug DNA
EUR 95

FXR2 ORF Vector (Human) (pORF)

ORF004231 1.0 ug DNA
EUR 95

Fxr2 ORF Vector (Mouse) (pORF)

ORF045159 1.0 ug DNA
EUR 506

Fxr2 sgRNA CRISPR Lentivector set (Rat)

K6104101 3 x 1.0 ug
EUR 339

FXR2 sgRNA CRISPR Lentivector set (Human)

K0823801 3 x 1.0 ug
EUR 339

Fxr2 sgRNA CRISPR Lentivector set (Mouse)

K4381101 3 x 1.0 ug
EUR 339

Monoclonal FXR2 Antibody (aa414-658, clone 1G2), Clone: 1G2

APG03296G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human FXR2 (aa414-658, clone 1G2). The antibodies are raised in Mouse and are from clone 1G2. This antibody is applicable in WB and IHC-P

Fragile X Mental Retardation, Autosomal Homolog 2 (FXR2) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Fragile X Mental Retardation, Autosomal Homolog 2 (FXR2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fragile X Mental Retardation, Autosomal Homolog 2 (FXR2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fragile X Mental Retardation, Autosomal Homolog 2 (FXR2) Antibody

abx122505-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Fragile X Mental Retardation, Autosomal Homolog 2 (FXR2) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Fragile X Mental Retardation, Autosomal Homolog 2 (FXR2) Antibody

abx233257-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Fragile X Mental Retardation, Autosomal Homolog 2 (FXR2) Antibody

abx331510-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Fragile X Mental Retardation, Autosomal Homolog 2 (FXR2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fxr2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6104102 1.0 ug DNA
EUR 154

Fxr2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6104103 1.0 ug DNA
EUR 154

Fxr2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6104104 1.0 ug DNA
EUR 154

FXR2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0823802 1.0 ug DNA
EUR 154

FXR2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0823803 1.0 ug DNA
EUR 154

FXR2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0823804 1.0 ug DNA
EUR 154

Fxr2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4381102 1.0 ug DNA
EUR 154

Fxr2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4381103 1.0 ug DNA
EUR 154

Fxr2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4381104 1.0 ug DNA
EUR 154

FXR2 Protein Vector (Rat) (pPB-C-His)

PV269230 500 ng
EUR 1166

FXR2 Protein Vector (Rat) (pPB-N-His)

PV269231 500 ng
EUR 1166

FXR2 Protein Vector (Rat) (pPM-C-HA)

PV269232 500 ng
EUR 1166

FXR2 Rabbit Polyclonal Antibody