FAM48A Rabbit Polyclonal Antibody

FAM48A Polyclonal Antibody
ES8546-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against FAM48A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Fam48a/ Rat Fam48a ELISA Kit
ELI-09774r	Lifescience Market	96 Tests	EUR 886

Anti-FAM48A Antibody
A11433	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for FAM48A Antibody (SUPT20H) detection. Tested with WB in Human, Mouse, Rat.

anti- FAM48A antibody
FNab02986	FN Test	100µg	EUR 585
Immunogen: family with sequence similarity 48, member A Uniprot ID: Q8NEM7 Research Area: Developmental biology
Description: Antibody raised against FAM48A

Anti-FAM48A antibody
PAab02986	Lifescience Market	100 ug	EUR 412

Anti-FAM48A antibody
STJ98659	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to FAM48A.

Human Protein FAM48A, FAM48A ELISA KIT
ELI-09807h	Lifescience Market	96 Tests	EUR 824

Chicken Protein FAM48A, FAM48A ELISA KIT
ELI-47764c	Lifescience Market	96 Tests	EUR 928

Mouse Protein FAM48A, Fam48a ELISA KIT
ELI-47765m	Lifescience Market	96 Tests	EUR 865

FAM48A cloning plasmid
CSB-CL818775HU-10ug	Cusabio	10ug	EUR 765
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2340 Sequence: atgcaacaagctttagaactagctttggatcgtgcagagtatgtcattgaaagtgcccgacagagacctcctaaaaggaaatacctatcaagtggaagaaaatctgtatttcaaaaactttatgacttgtatattgaagaatgtgaaaaagaacctgaagttaagaaattaagaa Show more
Description: A cloning plasmid for the FAM48A gene.

FAM48A ELISA KIT|Human
EF009537	Lifescience Market	96 Tests	EUR 689

FAM48A Recombinant Protein (Human)
RP011569	ABM	100 ug	Ask for price

FAM48A Recombinant Protein (Rat)
RP200663	ABM	100 ug	Ask for price

FAM48A Recombinant Protein (Mouse)
RP133427	ABM	100 ug	Ask for price

Fam48a ORF Vector (Rat) (pORF)
ORF066889	ABM	1.0 ug DNA	EUR 506

FAM48A ORF Vector (Human) (pORF)
ORF003857	ABM	1.0 ug DNA	EUR 95

Fam48a ORF Vector (Mouse) (pORF)
ORF044477	ABM	1.0 ug DNA	EUR 506

FAM48A sgRNA CRISPR Lentivector set (Human)
K0723901	ABM	3 x 1.0 ug	EUR 339

Fam48a sgRNA CRISPR Lentivector set (Mouse)
K4815301	ABM	3 x 1.0 ug	EUR 339

Fam48a sgRNA CRISPR Lentivector set (Rat)
K6431301	ABM	3 x 1.0 ug	EUR 339

Family With Sequence Similarity 48 Member A (FAM48A) Antibody
abx340073-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Family With Sequence Similarity 48 Member A (FAM48A) Antibody
abx232986-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

FAM48A sgRNA CRISPR Lentivector (Human) (Target 1)
K0723902	ABM	1.0 ug DNA	EUR 154

FAM48A sgRNA CRISPR Lentivector (Human) (Target 2)
K0723903	ABM	1.0 ug DNA	EUR 154

FAM48A sgRNA CRISPR Lentivector (Human) (Target 3)
K0723904	ABM	1.0 ug DNA	EUR 154

Fam48a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4815302	ABM	1.0 ug DNA	EUR 154

Fam48a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4815303	ABM	1.0 ug DNA	EUR 154

Fam48a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4815304	ABM	1.0 ug DNA	EUR 154

Fam48a sgRNA CRISPR Lentivector (Rat) (Target 1)
K6431302	ABM	1.0 ug DNA	EUR 154

Fam48a sgRNA CRISPR Lentivector (Rat) (Target 2)
K6431303	ABM	1.0 ug DNA	EUR 154

Fam48a sgRNA CRISPR Lentivector (Rat) (Target 3)
K6431304	ABM	1.0 ug DNA	EUR 154

FAM48A Protein Vector (Mouse) (pPB-C-His)
PV177906	ABM	500 ng	EUR 603

FAM48A Protein Vector (Mouse) (pPB-N-His)
PV177907	ABM	500 ng	EUR 603

FAM48A Protein Vector (Mouse) (pPM-C-HA)
PV177908	ABM	500 ng	EUR 603

FAM48A Protein Vector (Mouse) (pPM-C-His)
PV177909	ABM	500 ng	EUR 603

FAM48A Protein Vector (Rat) (pPB-C-His)
PV267554	ABM	500 ng	EUR 603

FAM48A Protein Vector (Rat) (pPB-N-His)
PV267555	ABM	500 ng	EUR 603

FAM48A Protein Vector (Rat) (pPM-C-HA)
PV267556	ABM	500 ng	EUR 603

FAM48A Protein Vector (Rat) (pPM-C-His)
PV267557	ABM	500 ng	EUR 603

FAM48A Protein Vector (Human) (pPB-C-His)
PV015425	ABM	500 ng	EUR 329

FAM48A Protein Vector (Human) (pPB-N-His)
PV015426	ABM	500 ng	EUR 329

FAM48A Protein Vector (Human) (pPM-C-HA)
PV015427	ABM	500 ng	EUR 329

FAM48A Protein Vector (Human) (pPM-C-His)
PV015428	ABM	500 ng	EUR 329

Fam48a 3'UTR GFP Stable Cell Line
TU156273	ABM	1.0 ml	Ask for price

Fam48a 3'UTR Luciferase Stable Cell Line
TU106273	ABM	1.0 ml	Ask for price

Fam48a 3'UTR Luciferase Stable Cell Line
TU204372	ABM	1.0 ml	Ask for price

Fam48a 3'UTR GFP Stable Cell Line
TU254372	ABM	1.0 ml	Ask for price

FAM48A 3'UTR GFP Stable Cell Line
TU057328	ABM	1.0 ml	EUR 1394

FAM48A 3'UTR Luciferase Stable Cell Line
TU007328	ABM	1.0 ml	EUR 1394

FAM48A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV658225	ABM	1.0 ug DNA	EUR 682

FAM48A Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV658229	ABM	1.0 ug DNA	EUR 682

FAM48A Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV658230	ABM	1.0 ug DNA	EUR 682

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

FAM48A Rabbit Polyclonal Antibody