FAM3D Rabbit Polyclonal Antibody

FAM3D Polyclonal Antibody

ABP57503-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from FAM3D at AA range: 121-170
  • Applications tips:
Description: A polyclonal antibody for detection of FAM3D from Human. This FAM3D antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from FAM3D at AA range: 121-170

FAM3D Polyclonal Antibody

ABP57503-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from FAM3D at AA range: 121-170
  • Applications tips:
Description: A polyclonal antibody for detection of FAM3D from Human. This FAM3D antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from FAM3D at AA range: 121-170

FAM3D Polyclonal Antibody

ABP57503-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from FAM3D at AA range: 121-170
  • Applications tips:
Description: A polyclonal antibody for detection of FAM3D from Human. This FAM3D antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from FAM3D at AA range: 121-170

FAM3D Polyclonal Antibody

ABP53761-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human FAM3D
  • Applications tips:
Description: A polyclonal antibody for detection of FAM3D from Human. This FAM3D antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human FAM3D

FAM3D Polyclonal Antibody

ABP53761-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human FAM3D
  • Applications tips:
Description: A polyclonal antibody for detection of FAM3D from Human. This FAM3D antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human FAM3D

FAM3D Polyclonal Antibody

ABP53761-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human FAM3D
  • Applications tips:
Description: A polyclonal antibody for detection of FAM3D from Human. This FAM3D antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human FAM3D

FAM3D Rabbit pAb

A17823-100ul 100 ul
EUR 308

FAM3D Rabbit pAb

A17823-200ul 200 ul
EUR 459

FAM3D Rabbit pAb

A17823-20ul 20 ul
EUR 183

FAM3D Rabbit pAb

A17823-50ul 50 ul
EUR 223

FAM3D Rabbit pAb

A17824-100ul 100 ul
EUR 308

FAM3D Rabbit pAb

A17824-200ul 200 ul
EUR 459

FAM3D Rabbit pAb

A17824-20ul 20 ul
EUR 183

FAM3D Rabbit pAb

A17824-50ul 50 ul
EUR 223

FAM3D antibody

70R-4572 50 ug
EUR 467
Description: Rabbit polyclonal FAM3D antibody raised against the middle region of FAM3D

FAM3D Antibody

ABD4832 100 ug
EUR 438

FAM3D Antibody

35324-100ul 100ul
EUR 252

FAM3D Antibody

35324-50ul 50ul
EUR 187

FAM3D Antibody

42987-100ul 100ul
EUR 252

FAM3D antibody

70R-17221 50 ul
EUR 435
Description: Rabbit polyclonal FAM3D antibody

FAM3D Antibody

DF4832 200ul
EUR 304
Description: FAM3D Antibody detects endogenous levels of total FAM3D.

FAM3D Antibody

1-CSB-PA007145
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FAM3D. Recognizes FAM3D from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

FAM3D Antibody

1-CSB-PA008229GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FAM3D. Recognizes FAM3D from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FAM3D Antibody

1-CSB-PA834780
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FAM3D. Recognizes FAM3D from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

FAM3D Antibody

CSB-PA586397-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FAM3D. Recognizes FAM3D from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FAM3D Antibody

CSB-PA586397-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FAM3D. Recognizes FAM3D from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FAM3D Conjugated Antibody

C35324 100ul
EUR 397

anti- FAM3D antibody

FNab02983 100µg
EUR 548.75
  • Immunogen: family with sequence similarity 3, member D
  • Uniprot ID: Q96BQ1
  • Gene ID: 131177
  • Research Area: Cell Division and Proliferation, Signal Transduction
Description: Antibody raised against FAM3D

Anti-FAM3D antibody

PAab02983 100 ug
EUR 386

Anti-FAM3D antibody

STJ93036 200 µl
EUR 197
Description: Rabbit polyclonal to FAM3D.

Anti-FAM3D antibody

STJ98609 200 µl
EUR 197
Description: Rabbit polyclonal to FAM3D.

Anti-FAM3D antibody

STJ119847 100 µl
EUR 277

Anti-FAM3D antibody

STJ119848 100 µl
EUR 277

Human FAM3D (Protein FAM3D) ELISA Kit

ELI-47388h 96 Tests
EUR 720

Mouse FAM3D(Protein FAM3D) ELISA Kit

EM1709 96T
EUR 567.6
  • Detection range: 1.56-100 pg/ml
  • Alias: FAM3D/Protein FAM3D/EF7/ OIT1/ cytokine-like protein EF-7/ family with sequence similarity 3, member D/ family with sequence similarity 3 member D
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.938pg/ml

Human Protein FAM3D (FAM3D) ELISA Kit

abx387274-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Protein FAM3D(FAM3D) ELISA kit

CSB-EL008229HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein FAM3D (FAM3D) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protein FAM3D(FAM3D) ELISA kit

1-CSB-EL008229HU
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein FAM3D(FAM3D) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Protein FAM3D(FAM3D) ELISA kit

CSB-EL008229MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein FAM3D (FAM3D) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Protein FAM3D(FAM3D) ELISA kit

1-CSB-EL008229MO
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein FAM3D(FAM3D) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

FAM3D siRNA

20-abx916320
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FAM3D siRNA

20-abx916321
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-FAM3D

YF-PA22196 50 ul
EUR 363
Description: Mouse polyclonal to FAM3D

anti-FAM3D

YF-PA22198 50 ug
EUR 363
Description: Mouse polyclonal to FAM3D

Mouse FAM3D (Protein FAM3D) ELISA Kit (CUSTOM)

ELI-20793m 96 Tests
EUR 100

FAM3D ELISA Kit| Mouse Protein FAM3D ELISA Kit

EF014065 96 Tests
EUR 689

FAM3D Blocking Peptide

33R-5499 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FAM3D antibody, catalog no. 70R-4572

FAM3D cloning plasmid

CSB-CL856903HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 675
  • Sequence: atgagagtgtcaggtgtgcttcgcctcctggccctcatctttgccatagtcacgacatggatgtttattcgaagctacatgagcttcagcatgaaaaccatccgtctgccacgctggctggcagcctcgcccaccaaggagatccaggttaaaaagtacaagtgtggcctcatcaa
  • Show more
Description: A cloning plasmid for the FAM3D gene.

FAM3D Blocking Peptide

DF4832-BP 1mg
EUR 195

pCMV-SPORT6-FAM3D

PVT13518 2 ug
EUR 391

Human FAM3D shRNA Plasmid

20-abx965057
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FAM3D ELISA KIT|Human

EF009534 96 Tests
EUR 689

Mouse FAM3D shRNA Plasmid

20-abx971862
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FAM3D Recombinant Protein (Human)

RP011536 100 ug Ask for price

FAM3D Recombinant Protein (Rat)

RP200642 100 ug Ask for price

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human)

4-PAK368Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D)

FAM3D ORF Vector (Human) (pORF)

ORF003846 1.0 ug DNA
EUR 95

Fam3d ORF Vector (Rat) (pORF)

ORF066882 1.0 ug DNA
EUR 506

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), APC

4-PAK368Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with APC.

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), Biotinylated

4-PAK368Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with Biotin.

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), Cy3

4-PAK368Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with Cy3.

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), FITC

4-PAK368Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with FITC.

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), HRP

4-PAK368Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with HRP.

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), PE

4-PAK368Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with PE.

Recombinant Human Protein FAM3D (C-6His)

C344-10ug 10ug
EUR 156
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Protein FAM3D (C-6His)

C344-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Protein FAM3D (C-6His)

C344-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Protein FAM3D (C-6His)

C344-50ug 50ug
EUR 369
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

FAM3D sgRNA CRISPR Lentivector set (Human)

K0712701 3 x 1.0 ug
EUR 339

Fam3d sgRNA CRISPR Lentivector set (Rat)

K6602501 3 x 1.0 ug
EUR 339

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), APC-Cy7

4-PAK368Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with APC-Cy7.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody

20-abx112443
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody

20-abx129045
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody

20-abx015204
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody

20-abx324601
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody

20-abx324989
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody

abx340136-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody

abx330731-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody

abx232983-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

FAM3D sgRNA CRISPR Lentivector (Human) (Target 1)

K0712702 1.0 ug DNA
EUR 154

FAM3D sgRNA CRISPR Lentivector (Human) (Target 2)

K0712703 1.0 ug DNA
EUR 154

FAM3D sgRNA CRISPR Lentivector (Human) (Target 3)

K0712704 1.0 ug DNA
EUR 154

Fam3d sgRNA CRISPR Lentivector (Rat) (Target 1)

K6602502 1.0 ug DNA
EUR 154

Fam3d sgRNA CRISPR Lentivector (Rat) (Target 2)

K6602503 1.0 ug DNA
EUR 154

Fam3d sgRNA CRISPR Lentivector (Rat) (Target 3)

K6602504 1.0 ug DNA
EUR 154

Recombinant Human FAM3D Protein, His, E.coli-10ug

QP11847-10ug 10ug
EUR 201

Recombinant Human FAM3D Protein, His, E.coli-1mg

QP11847-1mg 1mg
EUR 5251

Recombinant Human FAM3D Protein, His, E.coli-2ug

QP11847-2ug 2ug
EUR 155

FAM3D Protein Vector (Human) (pPB-C-His)

PV015381 500 ng
EUR 329

FAM3D Protein Vector (Human) (pPB-N-His)

PV015382 500 ng
EUR 329

FAM3D Protein Vector (Human) (pPM-C-HA)

PV015383 500 ng
EUR 329

FAM3D Protein Vector (Human) (pPM-C-His)

PV015384 500 ng
EUR 329

FAM3D Protein Vector (Rat) (pPB-C-His)

PV267526 500 ng
EUR 603

FAM3D Protein Vector (Rat) (pPB-N-His)

PV267527 500 ng
EUR 603

FAM3D Protein Vector (Rat) (pPM-C-HA)

PV267528 500 ng
EUR 603

FAM3D Protein Vector (Rat) (pPM-C-His)

PV267529 500 ng
EUR 603

Fam3d 3'UTR Luciferase Stable Cell Line

TU204364 1.0 ml Ask for price

FAM3D 3'UTR Luciferase Stable Cell Line

TU007223 1.0 ml
EUR 1394

FAM3D 3'UTR GFP Stable Cell Line

TU057223 1.0 ml
EUR 1394

Fam3d 3'UTR GFP Stable Cell Line

TU254364 1.0 ml Ask for price

FAM3D Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV651847 1.0 ug DNA
EUR 514

FAM3D Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV651851 1.0 ug DNA
EUR 514

FAM3D Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV651852 1.0 ug DNA
EUR 514

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

FAM3D Rabbit Polyclonal Antibody