FAM3D Rabbit Polyclonal Antibody

FAM3D Polyclonal Antibody
ABP57503-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from FAM3D at AA range: 121-170
  • Applications tips:
Description: A polyclonal antibody for detection of FAM3D from Human. This FAM3D antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from FAM3D at AA range: 121-170

FAM3D Polyclonal Antibody
ABP57503-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from FAM3D at AA range: 121-170
  • Applications tips:
Description: A polyclonal antibody for detection of FAM3D from Human. This FAM3D antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from FAM3D at AA range: 121-170

FAM3D Polyclonal Antibody
ES8496-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FAM3D from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FAM3D Polyclonal Antibody
ES8496-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FAM3D from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FAM3D Polyclonal Antibody
ES4760-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FAM3D from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

FAM3D Polyclonal Antibody
ES4760-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FAM3D from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

FAM3D Rabbit pAb
A17823-100ul 100 ul
EUR 308

FAM3D Rabbit pAb
A17823-200ul 200 ul
EUR 459

FAM3D Rabbit pAb
A17823-20ul 20 ul
EUR 183

FAM3D Rabbit pAb
A17823-50ul 50 ul
EUR 223

FAM3D Rabbit pAb
A17824-100ul 100 ul
EUR 308

FAM3D Rabbit pAb
A17824-200ul 200 ul
EUR 459

FAM3D Rabbit pAb
A17824-20ul 20 ul
EUR 183

FAM3D Rabbit pAb
A17824-50ul 50 ul
EUR 223

FAM3D antibody
70R-17221 50 ul
EUR 435
Description: Rabbit polyclonal FAM3D antibody

FAM3D Antibody
35324-100ul 100ul
EUR 252

FAM3D Antibody
35324-50ul 50ul
EUR 187

FAM3D Antibody
42987-100ul 100ul
EUR 252

FAM3D Antibody
1-CSB-PA834780
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FAM3D. Recognizes FAM3D from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

FAM3D Antibody
DF4832 200ul
EUR 304
Description: FAM3D Antibody detects endogenous levels of total FAM3D.

FAM3D Antibody
CSB-PA586397-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FAM3D. Recognizes FAM3D from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FAM3D Antibody
CSB-PA586397-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FAM3D. Recognizes FAM3D from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FAM3D antibody
70R-4572 50 ug
EUR 467
Description: Rabbit polyclonal FAM3D antibody raised against the middle region of FAM3D

FAM3D Antibody
1-CSB-PA007145
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FAM3D. Recognizes FAM3D from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

FAM3D Antibody
1-CSB-PA008229GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FAM3D. Recognizes FAM3D from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FAM3D Antibody
ABD4832 100 ug
EUR 438

FAM3D Conjugated Antibody
C35324 100ul
EUR 397

anti- FAM3D antibody
FNab02983 100µg
EUR 548.75
  • Immunogen: family with sequence similarity 3, member D
  • Uniprot ID: Q96BQ1
  • Gene ID: 131177
  • Research Area: Cell Division and Proliferation, Signal Transduction
Description: Antibody raised against FAM3D

Anti-FAM3D antibody
PAab02983 100 ug
EUR 386

Anti-FAM3D antibody
STJ119847 100 µl
EUR 277

Anti-FAM3D antibody
STJ119848 100 µl
EUR 277

Anti-FAM3D antibody
STJ93036 200 µl
EUR 197
Description: Rabbit polyclonal to FAM3D.

Anti-FAM3D antibody
STJ98609 200 µl
EUR 197
Description: Rabbit polyclonal to FAM3D.

Human Protein FAM3D(FAM3D) ELISA kit
CSB-EL008229HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein FAM3D (FAM3D) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protein FAM3D(FAM3D) ELISA kit
1-CSB-EL008229HU
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein FAM3D(FAM3D) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Protein FAM3D(FAM3D) ELISA kit
CSB-EL008229MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein FAM3D (FAM3D) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Protein FAM3D(FAM3D) ELISA kit
1-CSB-EL008229MO
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein FAM3D(FAM3D) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Protein FAM3D (FAM3D) ELISA Kit
abx387274-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse FAM3D(Protein FAM3D) ELISA Kit
EM1709 96T
EUR 567.6
  • Detection range: 1.56-100 pg/ml
  • Alias: FAM3D/Protein FAM3D/EF7/ OIT1/ cytokine-like protein EF-7/ family with sequence similarity 3, member D/ family with sequence similarity 3 member D
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.938pg/ml

Human FAM3D (Protein FAM3D) ELISA Kit
ELI-47388h 96 Tests
EUR 720

FAM3D siRNA
20-abx916320
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FAM3D siRNA
20-abx916321
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-FAM3D
YF-PA22196 50 ul
EUR 363
Description: Mouse polyclonal to FAM3D

anti-FAM3D
YF-PA22198 50 ug
EUR 363
Description: Mouse polyclonal to FAM3D

Mouse FAM3D (Protein FAM3D) ELISA Kit (CUSTOM)
ELI-20793m 96 Tests
EUR 100

FAM3D ELISA Kit| Mouse Protein FAM3D ELISA Kit
EF014065 96 Tests
EUR 689

FAM3D Blocking Peptide
33R-5499 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FAM3D antibody, catalog no. 70R-4572

FAM3D Blocking Peptide
DF4832-BP 1mg
EUR 195

FAM3D cloning plasmid
CSB-CL856903HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 675
  • Sequence: atgagagtgtcaggtgtgcttcgcctcctggccctcatctttgccatagtcacgacatggatgtttattcgaagctacatgagcttcagcatgaaaaccatccgtctgccacgctggctggcagcctcgcccaccaaggagatccaggttaaaaagtacaagtgtggcctcatcaa
  • Show more
Description: A cloning plasmid for the FAM3D gene.

pCMV-SPORT6-FAM3D
PVT13518 2 ug
EUR 391

FAM3D ELISA KIT|Human
EF009534 96 Tests
EUR 689

Human FAM3D shRNA Plasmid
20-abx965057
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse FAM3D shRNA Plasmid
20-abx971862
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FAM3D Recombinant Protein (Human)
RP011536 100 ug Ask for price

FAM3D Recombinant Protein (Rat)
RP200642 100 ug Ask for price

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human)
4-PAK368Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D)

Fam3d ORF Vector (Rat) (pORF)
ORF066882 1.0 ug DNA
EUR 506

FAM3D ORF Vector (Human) (pORF)
ORF003846 1.0 ug DNA
EUR 95

FAM3D ELISA Kit (Human) (OKCA01454)
OKCA01454 96 Wells
EUR 846
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.156 ng/mL

FAM3D ELISA Kit (Human) (OKEH08044)
OKEH08044 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.28ng/mL

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), APC
4-PAK368Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with APC.

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), Biotinylated
4-PAK368Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with Biotin.

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), Cy3
4-PAK368Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with Cy3.

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), FITC
4-PAK368Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with FITC.

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), HRP
4-PAK368Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with HRP.

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), PE
4-PAK368Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with PE.

Recombinant Human Protein FAM3D (C-6His)
C344-10ug 10ug
EUR 156
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Protein FAM3D (C-6His)
C344-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Protein FAM3D (C-6His)
C344-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Protein FAM3D (C-6His)
C344-50ug 50ug
EUR 369
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

FAM3D sgRNA CRISPR Lentivector set (Human)
K0712701 3 x 1.0 ug
EUR 339

Fam3d sgRNA CRISPR Lentivector set (Rat)
K6602501 3 x 1.0 ug
EUR 339

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), APC-Cy7
4-PAK368Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with APC-Cy7.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody
20-abx015204
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody
20-abx112443
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody
20-abx129045
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody
abx340136-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody
abx330731-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody
20-abx324601
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody
20-abx324989
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody
abx232983-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

FAM3D sgRNA CRISPR Lentivector (Human) (Target 1)
K0712702 1.0 ug DNA
EUR 154

FAM3D sgRNA CRISPR Lentivector (Human) (Target 2)
K0712703 1.0 ug DNA
EUR 154

FAM3D sgRNA CRISPR Lentivector (Human) (Target 3)
K0712704 1.0 ug DNA
EUR 154

Fam3d sgRNA CRISPR Lentivector (Rat) (Target 1)
K6602502 1.0 ug DNA
EUR 154

Fam3d sgRNA CRISPR Lentivector (Rat) (Target 2)
K6602503 1.0 ug DNA
EUR 154

Fam3d sgRNA CRISPR Lentivector (Rat) (Target 3)
K6602504 1.0 ug DNA
EUR 154

FAM3D Protein Vector (Rat) (pPB-C-His)
PV267526 500 ng
EUR 603

FAM3D Protein Vector (Rat) (pPB-N-His)
PV267527 500 ng
EUR 603

FAM3D Protein Vector (Rat) (pPM-C-HA)
PV267528 500 ng
EUR 603

FAM3D Protein Vector (Rat) (pPM-C-His)
PV267529 500 ng
EUR 603

FAM3D Protein Vector (Human) (pPB-C-His)
PV015381 500 ng
EUR 329

FAM3D Protein Vector (Human) (pPB-N-His)
PV015382 500 ng
EUR 329

FAM3D Protein Vector (Human) (pPM-C-HA)
PV015383 500 ng
EUR 329

FAM3D Protein Vector (Human) (pPM-C-His)
PV015384 500 ng
EUR 329

Recombinant Human FAM3D Protein, His, E.coli-10ug
QP11847-10ug 10ug
EUR 201

Recombinant Human FAM3D Protein, His, E.coli-1mg
QP11847-1mg 1mg
EUR 5251

Recombinant Human FAM3D Protein, His, E.coli-2ug
QP11847-2ug 2ug
EUR 155

Fam3d 3'UTR Luciferase Stable Cell Line
TU204364 1.0 ml Ask for price

Fam3d 3'UTR GFP Stable Cell Line
TU254364 1.0 ml Ask for price

FAM3D 3'UTR GFP Stable Cell Line
TU057223 1.0 ml
EUR 1394

FAM3D 3'UTR Luciferase Stable Cell Line
TU007223 1.0 ml
EUR 1394

FAM3D Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV651847 1.0 ug DNA
EUR 514

FAM3D Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV651851 1.0 ug DNA
EUR 514

FAM3D Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV651852 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

FAM3D Rabbit Polyclonal Antibody