eIF5B Rabbit Polyclonal Antibody

eIF5B Polyclonal Antibody

ES8084-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against eIF5B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

eIF5B Polyclonal Antibody

ES8084-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against eIF5B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

EIF5B Rabbit pAb

A5888-100ul 100 ul
EUR 308

EIF5B Rabbit pAb

A5888-200ul 200 ul
EUR 459

EIF5B Rabbit pAb

A5888-20ul 20 ul
EUR 183

EIF5B Rabbit pAb

A5888-50ul 50 ul
EUR 223

EIF5B Rabbit pAb

A15123-100ul 100 ul
EUR 308

EIF5B Rabbit pAb

A15123-200ul 200 ul
EUR 459

EIF5B Rabbit pAb

A15123-20ul 20 ul
EUR 183

EIF5B Rabbit pAb

A15123-50ul 50 ul
EUR 223

EIF5B antibody

70R-17066 50 ul
EUR 435
Description: Rabbit polyclonal EIF5B antibody

EIF5B antibody

38709-100ul 100ul
EUR 252

EIF5B Antibody

1-CSB-PA080048
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF5B. Recognizes EIF5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

EIF5B Antibody

DF4055 200ul
EUR 304
Description: EIF5B Antibody detects endogenous levels of total EIF5B.

EIF5B antibody

70R-35227 100 ug
EUR 327
Description: Purified Rabbit polyclonal EIF5B antibody

EIF5B antibody

70R-50733 100 ul
EUR 244
Description: Purified Polyclonal EIF5B antibody

EIF5B Antibody

1-CSB-PA007581GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EIF5B. Recognizes EIF5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

EIF5B Antibody

ABD4055 100 ug
EUR 438

Eif5b/ Rat Eif5b ELISA Kit

ELI-07958r 96 Tests
EUR 886

EIF5B Conjugated Antibody

C38709 100ul
EUR 397

Anti-EIF5B Antibody

A30685 100ul
EUR 397
Description: Rabbit Polyclonal EIF5B Antibody. Validated in WB and tested in Human, Mouse, Rat.

anti- EIF5B antibody

FNab02730 100µg
EUR 548.75
  • Immunogen: eukaryotic translation initiation factor 5B
  • Uniprot ID: O60841
  • Gene ID: 9669
  • Research Area: Metabolism
Description: Antibody raised against EIF5B

Anti-EIF5B antibody

PAab02730 100 ug
EUR 386

Anti-EIF5B antibody

STJ116285 100 µl
EUR 277
Description: Accurate initiation of translation in eukaryotes is complex and requires many factors, some of which are composed of multiple subunits. The process is simpler in prokaryotes which have only three initiation factors (IF1, IF2, IF3). Two of these factors are conserved in eukaryotes: the homolog of IF1 is eIF1A and the homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and eIF5B interact on the ribosome along with other initiation factors and GTP to position the initiation methionine tRNA on the start codon of the mRNA so that translation initiates accurately.

Anti-EIF5B antibody

STJ117317 100 µl
EUR 277
Description: Accurate initiation of translation in eukaryotes is complex and requires many factors, some of which are composed of multiple subunits. The process is simpler in prokaryotes which have only three initiation factors (IF1, IF2, IF3). Two of these factors are conserved in eukaryotes: the homolog of IF1 is eIF1A and the homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and eIF5B interact on the ribosome along with other initiation factors and GTP to position the initiation methionine tRNA on the start codon of the mRNA so that translation initiates accurately.

Anti-eIF5B antibody

STJ92886 200 µl
EUR 197
Description: Rabbit polyclonal to eIF5B.

EIF5B siRNA

20-abx901692
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF5B siRNA

20-abx915226
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF5B siRNA

20-abx915227
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-EIF5B

YF-PA16474 50 ug
EUR 363
Description: Mouse polyclonal to EIF5B

anti-EIF5B

YF-PA25392 50 ul
EUR 334
Description: Mouse polyclonal to EIF5B

EIF5B Blocking Peptide

DF4055-BP 1mg
EUR 195

EIF5B Blocking Peptide

20-abx063608
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

EIF5B cloning plasmid

CSB-CL007581HU-10ug 10ug
EUR 1293
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3663
  • Sequence: atggggaagaaacagaaaaacaagagcgaagacagcaccaaggatgacattgatcttgatgccttggctgcagaaatagaaggagctggtgctgccaaagaacaggagcctcaaaagtcaaaagggaaaaagaaaaaagagaaaaaaaagcaggactttgatgaagatgatatcc
  • Show more
Description: A cloning plasmid for the EIF5B gene.

Anti-EIF5B (3F9)

YF-MA16972 100 ug
EUR 363
Description: Mouse monoclonal to EIF5B

Human EIF5B ELISA KIT

ELI-20271h 96 Tests
EUR 824

Mouse Eif5b ELISA KIT

ELI-21436m 96 Tests
EUR 865

EIF5B ELISA KIT|Human

EF009361 96 Tests
EUR 689

Rat EIF5B shRNA Plasmid

20-abx989477
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EIF5B shRNA Plasmid

20-abx956443
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EIF5B shRNA Plasmid

20-abx981530
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody

20-abx008399
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody

20-abx004515
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody

abx216136-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody

20-abx112392
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody

20-abx119110
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody

20-abx328778
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody

abx232730-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Eif5b ORF Vector (Rat) (pORF)

ORF066478 1.0 ug DNA
EUR 506

EIF5B ORF Vector (Human) (pORF)

ORF003502 1.0 ug DNA
EUR 95

Eif5b ORF Vector (Mouse) (pORF)

ORF043811 1.0 ug DNA
EUR 506

EIF5B sgRNA CRISPR Lentivector set (Human)

K0672201 3 x 1.0 ug
EUR 339

Eif5b sgRNA CRISPR Lentivector set (Rat)

K7336901 3 x 1.0 ug
EUR 339

Eif5b sgRNA CRISPR Lentivector set (Mouse)

K4811301 3 x 1.0 ug
EUR 339

EIF5B sgRNA CRISPR Lentivector (Human) (Target 1)

K0672202 1.0 ug DNA
EUR 154

EIF5B sgRNA CRISPR Lentivector (Human) (Target 2)

K0672203 1.0 ug DNA
EUR 154

EIF5B sgRNA CRISPR Lentivector (Human) (Target 3)

K0672204 1.0 ug DNA
EUR 154

Eif5b sgRNA CRISPR Lentivector (Rat) (Target 1)

K7336902 1.0 ug DNA
EUR 154

Eif5b sgRNA CRISPR Lentivector (Rat) (Target 2)

K7336903 1.0 ug DNA
EUR 154

Eif5b sgRNA CRISPR Lentivector (Rat) (Target 3)

K7336904 1.0 ug DNA
EUR 154

Eif5b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4811302 1.0 ug DNA
EUR 154

Eif5b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4811303 1.0 ug DNA
EUR 154

Eif5b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4811304 1.0 ug DNA
EUR 154

EIF5B Protein Vector (Mouse) (pPB-C-His)

PV175242 500 ng
EUR 1065

EIF5B Protein Vector (Mouse) (pPB-N-His)

PV175243 500 ng
EUR 1065

EIF5B Protein Vector (Mouse) (pPM-C-HA)

PV175244 500 ng
EUR 1065

EIF5B Protein Vector (Mouse) (pPM-C-His)

PV175245 500 ng
EUR 1065

EIF5B Protein Vector (Rat) (pPB-C-His)

PV265910 500 ng
EUR 1191

EIF5B Protein Vector (Rat) (pPB-N-His)

PV265911 500 ng
EUR 1191

EIF5B Protein Vector (Rat) (pPM-C-HA)

PV265912 500 ng
EUR 1191

EIF5B Protein Vector (Rat) (pPM-C-His)

PV265913 500 ng
EUR 1191

EIF5B Protein Vector (Human) (pPB-C-His)

PV014005 500 ng
EUR 329

EIF5B Protein Vector (Human) (pPB-N-His)

PV014006 500 ng
EUR 329

EIF5B Protein Vector (Human) (pPM-C-HA)

PV014007 500 ng
EUR 329

EIF5B Protein Vector (Human) (pPM-C-His)

PV014008 500 ng
EUR 329

Eif5b 3'UTR GFP Stable Cell Line

TU155745 1.0 ml Ask for price

Eif5b 3'UTR Luciferase Stable Cell Line

TU105745 1.0 ml Ask for price

Eif5b 3'UTR Luciferase Stable Cell Line

TU203912 1.0 ml Ask for price

Eif5b 3'UTR GFP Stable Cell Line

TU253912 1.0 ml Ask for price

EIF5B 3'UTR GFP Stable Cell Line

TU056803 1.0 ml
EUR 1394

EIF5B 3'UTR Luciferase Stable Cell Line

TU006803 1.0 ml
EUR 1394

EIF5B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV686233 1.0 ug DNA
EUR 1355

EIF5B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV686237 1.0 ug DNA
EUR 1355

EIF5B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV686238 1.0 ug DNA
EUR 1355

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

eIF5B Rabbit Polyclonal Antibody