DZIP3 Rabbit Polyclonal Antibody

DZIP3 Polyclonal Antibody

ABP57084-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human DZIP3 at AA range: 650-730
  • Applications tips:
Description: A polyclonal antibody for detection of DZIP3 from Human. This DZIP3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human DZIP3 at AA range: 650-730

DZIP3 Polyclonal Antibody

ABP57084-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human DZIP3 at AA range: 650-730
  • Applications tips:
Description: A polyclonal antibody for detection of DZIP3 from Human. This DZIP3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human DZIP3 at AA range: 650-730

DZIP3 Polyclonal Antibody

ABP57084-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human DZIP3 at AA range: 650-730
  • Applications tips:
Description: A polyclonal antibody for detection of DZIP3 from Human. This DZIP3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human DZIP3 at AA range: 650-730

DZIP3 Rabbit pAb

A7179-100ul 100 ul
EUR 308

DZIP3 Rabbit pAb

A7179-200ul 200 ul
EUR 459

DZIP3 Rabbit pAb

A7179-20ul 20 ul
EUR 183

DZIP3 Rabbit pAb

A7179-50ul 50 ul
EUR 223

DZIP3 antibody

70R-35104 100 ug
EUR 327
Description: Purified Rabbit polyclonal DZIP3 antibody

DZIP3 Antibody

ABD4017 100 ug
EUR 438

DZIP3 Antibody

47820-100ul 100ul
EUR 252

DZIP3 Antibody

DF4017 200ul
EUR 304
Description: DZIP3 Antibody detects endogenous levels of total DZIP3.

DZIP3 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DZIP3. Recognizes DZIP3 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

DZIP3 Conjugated Antibody

C47820 100ul
EUR 397

Anti-DZIP3 antibody

STJ92805 200 µl
EUR 197
Description: Rabbit polyclonal to DZIP3.

Anti-DZIP3 antibody

STJ29259 100 µl
EUR 277


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA25391 50 ul
EUR 334
Description: Mouse polyclonal to DZIP3

DZIP3 Blocking Peptide

  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

DZIP3 Blocking Peptide

DF4017-BP 1mg
EUR 195

DZIP3 cloning plasmid

CSB-CL771469HU-10ug 10ug
EUR 1281
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3627
  • Sequence: atggattctctaccagatgaattttttgtgaggcatcctgctgtggaggatcagaggaaggaagaaactgagaataagctagaaaaatcatctggtcaactgaacaaacaggaaaatgacatacctactgatcttgtccctgttaacctactattagaagtgaagaagttattaa
  • Show more
Description: A cloning plasmid for the DZIP3 gene.

Anti-DZIP3 (3A1)

YF-MA16970 100 ug
EUR 363
Description: Mouse monoclonal to DZIP3

Mouse E3 ubiquitin- protein ligase DZIP3, Dzip3 ELISA KIT

ELI-26572m 96 Tests
EUR 865

Human E3 ubiquitin- protein ligase DZIP3, DZIP3 ELISA KIT

ELI-09249h 96 Tests
EUR 824

Mouse DZIP3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DZIP3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6.1-DZIP3 Plasmid

PVT16913 2 ug
EUR 325

DZIP3 ORF Vector (Human) (pORF)

ORF003356 1.0 ug DNA
EUR 95

Dzip3 ORF Vector (Mouse) (pORF)

ORF043502 1.0 ug DNA
EUR 506

Dzip3 ORF Vector (Mouse) (pORF)

ORF043503 1.0 ug DNA
EUR 506

DAZ Interacting Zinc Finger Protein 3 (DZIP3) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

DAZ Interacting Zinc Finger Protein 3 (DZIP3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

DAZ Interacting Zinc Finger Protein 3 (DZIP3) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

DZIP3 sgRNA CRISPR Lentivector set (Human)

K0647801 3 x 1.0 ug
EUR 339

Dzip3 sgRNA CRISPR Lentivector set (Mouse)

K4754001 3 x 1.0 ug
EUR 339

DZIP3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0647802 1.0 ug DNA
EUR 154

DZIP3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0647803 1.0 ug DNA
EUR 154

DZIP3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0647804 1.0 ug DNA
EUR 154

Dzip3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4754002 1.0 ug DNA
EUR 154

Dzip3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4754003 1.0 ug DNA
EUR 154

Dzip3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4754004 1.0 ug DNA
EUR 154

DZIP3 Protein Vector (Mouse) (pPB-C-His)

PV174006 500 ng
EUR 1065

DZIP3 Protein Vector (Mouse) (pPB-N-His)

PV174007 500 ng
EUR 1065

DZIP3 Protein Vector (Mouse) (pPM-C-HA)

PV174008 500 ng
EUR 1065

DZIP3 Protein Vector (Mouse) (pPM-C-His)

PV174009 500 ng
EUR 1065

DZIP3 Protein Vector (Mouse) (pPB-C-His)

PV174010 500 ng
EUR 1065

DZIP3 Protein Vector (Mouse) (pPB-N-His)

PV174011 500 ng
EUR 1065

DZIP3 Protein Vector (Mouse) (pPM-C-HA)

PV174012 500 ng
EUR 1065

DZIP3 Protein Vector (Mouse) (pPM-C-His)

PV174013 500 ng
EUR 1065

DZIP3 Protein Vector (Human) (pPB-C-His)

PV013421 500 ng
EUR 329

DZIP3 Protein Vector (Human) (pPB-N-His)

PV013422 500 ng
EUR 329

DZIP3 Protein Vector (Human) (pPM-C-HA)

PV013423 500 ng
EUR 329

DZIP3 Protein Vector (Human) (pPM-C-His)

PV013424 500 ng
EUR 329

Dzip3 3'UTR GFP Stable Cell Line

TU155507 1.0 ml Ask for price

DZIP3 3'UTR Luciferase Stable Cell Line

TU006498 1.0 ml
EUR 2333

Dzip3 3'UTR Luciferase Stable Cell Line

TU105507 1.0 ml Ask for price

DZIP3 3'UTR GFP Stable Cell Line

TU056498 1.0 ml
EUR 2333

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

DZIP3 Rabbit Polyclonal Antibody