DUSP6 Rabbit Polyclonal Antibody

DUSP6 Polyclonal Antibody
ABP57351-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of DUSP6 from Human, Mouse, Rat. This DUSP6 antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

DUSP6 Polyclonal Antibody
ABP57351-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of DUSP6 from Human, Mouse, Rat. This DUSP6 antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

DUSP6 Polyclonal Antibody
ES8344-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against DUSP6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA

DUSP6 Polyclonal Antibody
ES8344-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against DUSP6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA

Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit
DLR-DUSP6-Hu-48T	DL Develop	48T	EUR 517
Should the Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dual Specificity Phosphatase 6 (DUSP6) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit
DLR-DUSP6-Hu-96T	DL Develop	96T	EUR 673
Should the Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dual Specificity Phosphatase 6 (DUSP6) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit
RDR-DUSP6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit
RDR-DUSP6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit
RD-DUSP6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit
RD-DUSP6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

DUSP6 Rabbit pAb
A0637-100ul	Abclonal	100 ul	EUR 308

DUSP6 Rabbit pAb
A0637-200ul	Abclonal	200 ul	EUR 459

DUSP6 Rabbit pAb
A0637-20ul	Abclonal	20 ul	Ask for price

DUSP6 Rabbit pAb
A0637-50ul	Abclonal	50 ul	Ask for price

DUSP6 Rabbit mAb
A0133-100ul	Abclonal	100 ul	EUR 410

DUSP6 Rabbit mAb
A0133-200ul	Abclonal	200 ul	EUR 571

DUSP6 Rabbit mAb
A0133-20ul	Abclonal	20 ul	EUR 221

DUSP6 Rabbit mAb
A0133-50ul	Abclonal	50 ul	EUR 287

DUSP6 Rabbit pAb
A3171-100ul	Abclonal	100 ul	EUR 308

DUSP6 Rabbit pAb
A3171-200ul	Abclonal	200 ul	EUR 459

DUSP6 Rabbit pAb
A3171-20ul	Abclonal	20 ul	EUR 183

DUSP6 Rabbit pAb
A3171-50ul	Abclonal	50 ul	EUR 223

Polyclonal DUSP6 Antibody (Center)
AMM05849G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DUSP6 (Center). This antibody is tested and proven to work in the following applications:

DUSP6 Antibody
31069-100ul	SAB	100ul	EUR 252

DUSP6 Antibody
31069-50ul	SAB	50ul	EUR 187

DUSP6 antibody
70R-16958	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal DUSP6 antibody

DUSP6 antibody
70R-13417	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal DUSP6 antibody

DUSP6 antibody
70R-31932	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal DUSP6 antibody

DUSP6 Antibody
33916-100ul	SAB	100ul	EUR 252

DUSP6 Antibody
33916-50ul	SAB	50ul	EUR 187

DUSP6 antibody
38204-100ul	SAB	100ul	EUR 252

DUSP6 antibody
38613-100ul	SAB	100ul	EUR 252

DUSP6 Antibody
48635-100ul	SAB	100ul	EUR 333

DUSP6 Antibody
48635-50ul	SAB	50ul	EUR 239

DUSP6 Antibody
1-CSB-PA621973LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

DUSP6 Antibody
1-CSB-PA625538	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

DUSP6 Antibody
DF2919	Affbiotech	200ul	EUR 304
Description: DUSP6 Antibody detects endogenous levels of total DUSP6.

DUSP6 Antibody
DF6284	Affbiotech	200ul	EUR 304
Description: DUSP6 Antibody detects endogenous levels of total DUSP6.

DUSP6 Antibody
DF7228	Affbiotech	200ul	EUR 304
Description: DUSP6 Antibody detects endogenous levels of total DUSP6.

DUSP6 Antibody
1-CSB-PA251438	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

DUSP6 Antibody
1-CSB-PA274273	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:1000-3000

DUSP6 Antibody
CSB-PA230795-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

DUSP6 Antibody
CSB-PA230795-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

DUSP6 Antibody
1-CSB-PA007259GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DUSP6 Antibody
1-CSB-PA007843	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

DUSP6 Antibody
ABD2919	Lifescience Market	100 ug	EUR 438

DUSP6 Antibody
ABD6284	Lifescience Market	100 ug	EUR 438

DUSP6 Antibody
ABD7228	Lifescience Market	100 ug	EUR 438

Polyclonal DUSP6 / MKP3 Antibody (C-Term)
APR11807G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human DUSP6 / MKP3 (C-Term). This antibody is tested and proven to work in the following applications:

DUSP6 Conjugated Antibody
C48635	SAB	100ul	EUR 397

DUSP6 Conjugated Antibody
C31069	SAB	100ul	EUR 397

DUSP6 Conjugated Antibody
C38204	SAB	100ul	EUR 397

Anti-DUSP6 antibody
PAab02569	Lifescience Market	100 ug	EUR 355

Anti-DUSP6 antibody
STJ111007	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK2, is expressed in a variety of tissues with the highest levels in heart and pancreas, and unlike most other members of this family, is localized in the cytoplasm. Mutations in this gene have been associated with congenital hypogonadotropic hypogonadism. Alternatively spliced transcript variants have been found for this gene.

Anti-DUSP6 antibody
STJ23447	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK2, is expressed in a variety of tissues with the highest levels in heart and pancreas, and unlike most other members of this family, is localized in the cytoplasm. Mutations in this gene have been associated with congenital hypogonadotropic hypogonadism. Alternatively spliced transcript variants have been found for this gene.

Anti-DUSP6 antibody
STJ97598	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to DUSP6.

Anti-DUSP6/Mkp 3 Rabbit Monoclonal Antibody
M02157	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal DUSP6/Mkp 3 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat.

Dusp6/ Rat Dusp6 ELISA Kit
ELI-47163r	Lifescience Market	96 Tests	EUR 886

Rabbit Anti-DUSP6 monoclonal antibody, clone TS40-10
CABT-L577	Creative Diagnostics	100 ul	EUR 777

DUSP6 siRNA
20-abx901606	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DUSP6 siRNA
20-abx914762	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DUSP6 siRNA
20-abx914763	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pENTR223- DUSP6
PVT10010	Lifescience Market	2 ug	EUR 266

pDsRed2- Dusp6
PVT10260	Lifescience Market	2 ug	EUR 301

anti-DUSP6
YF-PA11443	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to DUSP6

anti-DUSP6
YF-PA11444	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to DUSP6

DUSP6 Antibody, HRP conjugated
1-CSB-PA621973LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DUSP6 Antibody, FITC conjugated
1-CSB-PA621973LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DUSP6 Antibody, Biotin conjugated
1-CSB-PA621973LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Antibody for Human DUSP6
SPC-1126D	Stressmarq	0.1ml	EUR 354
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is unconjugated.

Antibody for Human DUSP6
SPC-1126D-A390	Stressmarq	0.1ml	EUR 401
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 390.

Antibody for Human DUSP6
SPC-1126D-A488	Stressmarq	0.1ml	EUR 400
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 488.

Antibody for Human DUSP6
SPC-1126D-A565	Stressmarq	0.1ml	EUR 400
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 565.

Antibody for Human DUSP6
SPC-1126D-A594	Stressmarq	0.1ml	EUR 400
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 594.

Antibody for Human DUSP6
SPC-1126D-A633	Stressmarq	0.1ml	EUR 400
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 633.

Antibody for Human DUSP6
SPC-1126D-A655	Stressmarq	0.1ml	EUR 400
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 655.

Antibody for Human DUSP6
SPC-1126D-A680	Stressmarq	0.1ml	EUR 400
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 680.

Antibody for Human DUSP6
SPC-1126D-A700	Stressmarq	0.1ml	EUR 400
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 700.

Antibody for Human DUSP6
SPC-1126D-ALP	Stressmarq	0.1ml	EUR 394
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human DUSP6
SPC-1126D-APC	Stressmarq	0.1ml	EUR 399
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to APC .

Antibody for Human DUSP6
SPC-1126D-APCCY7	Stressmarq	0.1ml	EUR 471
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to APC/Cy7.

Antibody for Human DUSP6
SPC-1126D-BI	Stressmarq	0.1ml	EUR 396
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Biotin.

Antibody for Human DUSP6
SPC-1126D-DY350	Stressmarq	0.1ml	EUR 475
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 350.

Antibody for Human DUSP6
SPC-1126D-DY405	Stressmarq	0.1ml	EUR 452
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 405.

Antibody for Human DUSP6
SPC-1126D-DY488	Stressmarq	0.1ml	EUR 432
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 488.

Antibody for Human DUSP6
SPC-1126D-DY594	Stressmarq	0.1ml	EUR 436
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 594.

Antibody for Human DUSP6
SPC-1126D-DY633	Stressmarq	0.1ml	EUR 426
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 633.

Antibody for Human DUSP6
SPC-1126D-FITC	Stressmarq	0.1ml	EUR 392
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to FITC.

Antibody for Human DUSP6
SPC-1126D-HRP	Stressmarq	0.1ml	EUR 388
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to HRP.

Antibody for Human DUSP6
SPC-1126D-P594	Stressmarq	0.1ml	EUR 407
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to PE/ATTO 594.

Antibody for Human DUSP6
SPC-1126D-PCP	Stressmarq	0.1ml	EUR 399
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to PerCP.

Antibody for Human DUSP6
SPC-1126D-RPE	Stressmarq	0.1ml	EUR 397
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to RPE .

Antibody for Human DUSP6
SPC-1126D-STR	Stressmarq	0.1ml	EUR 398
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Streptavidin.

Antibody for Human DUSP6
SPC-1127D	Stressmarq	0.1ml	EUR 354
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is unconjugated.

Antibody for Human DUSP6
SPC-1127D-A390	Stressmarq	0.1ml	EUR 401
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 390.

Antibody for Human DUSP6
SPC-1127D-A488	Stressmarq	0.1ml	EUR 400
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 488.

Antibody for Human DUSP6
SPC-1127D-A565	Stressmarq	0.1ml	EUR 400
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 565.

Antibody for Human DUSP6
SPC-1127D-A594	Stressmarq	0.1ml	EUR 400
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 594.

Antibody for Human DUSP6
SPC-1127D-A633	Stressmarq	0.1ml	EUR 400
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 633.

Antibody for Human DUSP6
SPC-1127D-A655	Stressmarq	0.1ml	EUR 400
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 655.

Antibody for Human DUSP6
SPC-1127D-A680	Stressmarq	0.1ml	EUR 400
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 680.

Antibody for Human DUSP6
SPC-1127D-A700	Stressmarq	0.1ml	EUR 400
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 700.

Antibody for Human DUSP6
SPC-1127D-ALP	Stressmarq	0.1ml	EUR 394
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human DUSP6
SPC-1127D-APC	Stressmarq	0.1ml	EUR 399
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to APC .

Antibody for Human DUSP6
SPC-1127D-APCCY7	Stressmarq	0.1ml	EUR 471
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to APC/Cy7.

Antibody for Human DUSP6
SPC-1127D-BI	Stressmarq	0.1ml	EUR 396
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Biotin.

Antibody for Human DUSP6
SPC-1127D-DY350	Stressmarq	0.1ml	EUR 475
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 350.

Antibody for Human DUSP6
SPC-1127D-DY405	Stressmarq	0.1ml	EUR 452
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 405.

Antibody for Human DUSP6
SPC-1127D-DY488	Stressmarq	0.1ml	EUR 432
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 488.

Antibody for Human DUSP6
SPC-1127D-DY594	Stressmarq	0.1ml	EUR 436
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 594.

Antibody for Human DUSP6
SPC-1127D-DY633	Stressmarq	0.1ml	EUR 426
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 633.

Antibody for Human DUSP6
SPC-1127D-FITC	Stressmarq	0.1ml	EUR 392
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to FITC.

Antibody for Human DUSP6
SPC-1127D-HRP	Stressmarq	0.1ml	EUR 388
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to HRP.

Antibody for Human DUSP6
SPC-1127D-P594	Stressmarq	0.1ml	EUR 407
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to PE/ATTO 594.

Antibody for Human DUSP6
SPC-1127D-PCP	Stressmarq	0.1ml	EUR 399
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to PerCP.

Antibody for Human DUSP6
SPC-1127D-RPE	Stressmarq	0.1ml	EUR 397
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to RPE .

Antibody for Human DUSP6
SPC-1127D-STR	Stressmarq	0.1ml	EUR 398
DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Streptavidin.

Anti-DUSP6 / MKP3 antibody
STJ72927	St John's Laboratory	100 µg	EUR 359

DUSP6 Blocking Peptide
DF2919-BP	Affbiotech	1mg	EUR 195

DUSP6 Blocking Peptide
DF6284-BP	Affbiotech	1mg	EUR 195

DUSP6 Blocking Peptide
DF7228-BP	Affbiotech	1mg	EUR 195

DUSP6 Blocking Peptide
20-abx161601	Abbexa	EUR 606.00 EUR 1428.00	1 mg 5 mg
Shipped within 5-10 working days.

DUSP6 cloning plasmid
CSB-CL621973HU1-10ug	Cusabio	10ug	EUR 430
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1146 Sequence: atgatagatacgctcagacccgtgcccttcgcgtcggaaatggcgatcagcaagacggtggcgtggctcaacgagcagctggagctgggcaacgagcggctgctgctgatggactgccggccgcaggagctatacgagtcgtcgcacatcgagtcggccatcaacgtggccatcc Show more
Description: A cloning plasmid for the DUSP6 gene.

DUSP6 cloning plasmid
CSB-CL621973HU2-10ug	Cusabio	10ug	EUR 430
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1146 Sequence: atgatagatacgctcagacccgtgcccttcgcgtcggaaatggcgatcagcaagacggtggcgtggctcaacgagcagctggagctgggcaacgagcggctgctgctgatggactgccggccgcaggagctatacgagtcgtcgcacatcgagtcggccatcaacgtggccatcc Show more
Description: A cloning plasmid for the DUSP6 gene.

anti-DUSP6 (3G2)
LF-MA10089	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to DUSP6

pT7- His- Dusp6
PVT10145	Lifescience Market	2 ug	EUR 301

Anti-DUSP6 (3G2)
YF-MA12752	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to DUSP6

Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse)
4-PAF976Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DUSP6 (Met1~Ser300) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6)

Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), APC
4-PAF976Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DUSP6 (Met1~Ser300) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with APC.

Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAF976Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DUSP6 (Met1~Ser300) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with Biotin.

Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), Cy3
4-PAF976Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DUSP6 (Met1~Ser300) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with Cy3.

Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), FITC
4-PAF976Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DUSP6 (Met1~Ser300) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with FITC.

Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), HRP
4-PAF976Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DUSP6 (Met1~Ser300) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with HRP.

Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), PE
4-PAF976Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DUSP6 (Met1~Ser300) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with PE.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
20-abx214579	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
20-abx214744	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
20-abx112182	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
20-abx123735	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
20-abx125328	Abbexa	EUR 495.00 EUR 704.00 EUR 356.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
abx036164-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
20-abx129251	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
20-abx134468	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

DUSP6 Rabbit Polyclonal Antibody