DUSP6 Rabbit Polyclonal Antibody

DUSP6 Polyclonal Antibody

ABP57351-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of DUSP6 from Human, Mouse, Rat. This DUSP6 antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

DUSP6 Polyclonal Antibody

ABP57351-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of DUSP6 from Human, Mouse, Rat. This DUSP6 antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

DUSP6 Polyclonal Antibody

ES8344-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DUSP6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA

DUSP6 Polyclonal Antibody

ES8344-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DUSP6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA

Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit

DLR-DUSP6-Hu-48T 48T
EUR 517
  • Should the Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dual Specificity Phosphatase 6 (DUSP6) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit

DLR-DUSP6-Hu-96T 96T
EUR 673
  • Should the Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dual Specificity Phosphatase 6 (DUSP6) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit

RDR-DUSP6-Hu-48Tests 48 Tests
EUR 544

Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit

RDR-DUSP6-Hu-96Tests 96 Tests
EUR 756

Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit

RD-DUSP6-Hu-48Tests 48 Tests
EUR 521

Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit

RD-DUSP6-Hu-96Tests 96 Tests
EUR 723

DUSP6 Rabbit pAb

A0637-100ul 100 ul
EUR 308

DUSP6 Rabbit pAb

A0637-200ul 200 ul
EUR 459

DUSP6 Rabbit pAb

A0637-20ul 20 ul Ask for price

DUSP6 Rabbit pAb

A0637-50ul 50 ul Ask for price

DUSP6 Rabbit mAb

A0133-100ul 100 ul
EUR 410

DUSP6 Rabbit mAb

A0133-200ul 200 ul
EUR 571

DUSP6 Rabbit mAb

A0133-20ul 20 ul
EUR 221

DUSP6 Rabbit mAb

A0133-50ul 50 ul
EUR 287

DUSP6 Rabbit pAb

A3171-100ul 100 ul
EUR 308

DUSP6 Rabbit pAb

A3171-200ul 200 ul
EUR 459

DUSP6 Rabbit pAb

A3171-20ul 20 ul
EUR 183

DUSP6 Rabbit pAb

A3171-50ul 50 ul
EUR 223

Polyclonal DUSP6 Antibody (Center)

AMM05849G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DUSP6 (Center). This antibody is tested and proven to work in the following applications:

DUSP6 Antibody

31069-100ul 100ul
EUR 252

DUSP6 Antibody

31069-50ul 50ul
EUR 187

DUSP6 antibody

70R-16958 50 ul
EUR 435
Description: Rabbit polyclonal DUSP6 antibody

DUSP6 antibody

70R-13417 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal DUSP6 antibody

DUSP6 antibody

70R-31932 100 ug
EUR 327
Description: Rabbit polyclonal DUSP6 antibody

DUSP6 Antibody

33916-100ul 100ul
EUR 252

DUSP6 Antibody

33916-50ul 50ul
EUR 187

DUSP6 antibody

38204-100ul 100ul
EUR 252

DUSP6 antibody

38613-100ul 100ul
EUR 252

DUSP6 Antibody

48635-100ul 100ul
EUR 333

DUSP6 Antibody

48635-50ul 50ul
EUR 239

DUSP6 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

DUSP6 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

DUSP6 Antibody

DF2919 200ul
EUR 304
Description: DUSP6 Antibody detects endogenous levels of total DUSP6.

DUSP6 Antibody

DF6284 200ul
EUR 304
Description: DUSP6 Antibody detects endogenous levels of total DUSP6.

DUSP6 Antibody

DF7228 200ul
EUR 304
Description: DUSP6 Antibody detects endogenous levels of total DUSP6.

DUSP6 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

DUSP6 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:1000-3000

DUSP6 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

DUSP6 Antibody

CSB-PA230795-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

DUSP6 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DUSP6 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

DUSP6 Antibody

ABD2919 100 ug
EUR 438

DUSP6 Antibody

ABD6284 100 ug
EUR 438

DUSP6 Antibody

ABD7228 100 ug
EUR 438

Polyclonal DUSP6 / MKP3 Antibody (C-Term)

APR11807G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human DUSP6 / MKP3 (C-Term). This antibody is tested and proven to work in the following applications:

DUSP6 Conjugated Antibody

C48635 100ul
EUR 397

DUSP6 Conjugated Antibody

C31069 100ul
EUR 397

DUSP6 Conjugated Antibody

C38204 100ul
EUR 397

Anti-DUSP6 antibody

PAab02569 100 ug
EUR 355

Anti-DUSP6 antibody

STJ111007 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK2, is expressed in a variety of tissues with the highest levels in heart and pancreas, and unlike most other members of this family, is localized in the cytoplasm. Mutations in this gene have been associated with congenital hypogonadotropic hypogonadism. Alternatively spliced transcript variants have been found for this gene.

Anti-DUSP6 antibody

STJ23447 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK2, is expressed in a variety of tissues with the highest levels in heart and pancreas, and unlike most other members of this family, is localized in the cytoplasm. Mutations in this gene have been associated with congenital hypogonadotropic hypogonadism. Alternatively spliced transcript variants have been found for this gene.

Anti-DUSP6 antibody

STJ97598 200 µl
EUR 197
Description: Rabbit polyclonal to DUSP6.

Anti-DUSP6/Mkp 3 Rabbit Monoclonal Antibody

M02157 100ug/vial
EUR 397
Description: Rabbit Monoclonal DUSP6/Mkp 3 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat.

Dusp6/ Rat Dusp6 ELISA Kit

ELI-47163r 96 Tests
EUR 886

Rabbit Anti-DUSP6 monoclonal antibody, clone TS40-10

CABT-L577 100 ul
EUR 777


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT10010 2 ug
EUR 266

pDsRed2- Dusp6

PVT10260 2 ug
EUR 301


YF-PA11443 50 ug
EUR 363
Description: Mouse polyclonal to DUSP6


YF-PA11444 100 ug
EUR 403
Description: Rabbit polyclonal to DUSP6

DUSP6 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DUSP6 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DUSP6 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Antibody for Human DUSP6

SPC-1126D 0.1ml
EUR 354
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is unconjugated.

Antibody for Human DUSP6

SPC-1126D-A390 0.1ml
EUR 401
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 390.

Antibody for Human DUSP6

SPC-1126D-A488 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 488.

Antibody for Human DUSP6

SPC-1126D-A565 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 565.

Antibody for Human DUSP6

SPC-1126D-A594 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 594.

Antibody for Human DUSP6

SPC-1126D-A633 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 633.

Antibody for Human DUSP6

SPC-1126D-A655 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 655.

Antibody for Human DUSP6

SPC-1126D-A680 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 680.

Antibody for Human DUSP6

SPC-1126D-A700 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 700.

Antibody for Human DUSP6

SPC-1126D-ALP 0.1ml
EUR 394
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human DUSP6

SPC-1126D-APC 0.1ml
EUR 399
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to APC .

Antibody for Human DUSP6

SPC-1126D-APCCY7 0.1ml
EUR 471
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to APC/Cy7.

Antibody for Human DUSP6

SPC-1126D-BI 0.1ml
EUR 396
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Biotin.

Antibody for Human DUSP6

SPC-1126D-DY350 0.1ml
EUR 475
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 350.

Antibody for Human DUSP6

SPC-1126D-DY405 0.1ml
EUR 452
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 405.

Antibody for Human DUSP6

SPC-1126D-DY488 0.1ml
EUR 432
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 488.

Antibody for Human DUSP6

SPC-1126D-DY594 0.1ml
EUR 436
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 594.

Antibody for Human DUSP6

SPC-1126D-DY633 0.1ml
EUR 426
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 633.

Antibody for Human DUSP6

SPC-1126D-FITC 0.1ml
EUR 392
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to FITC.

Antibody for Human DUSP6

SPC-1126D-HRP 0.1ml
EUR 388
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to HRP.

Antibody for Human DUSP6

SPC-1126D-P594 0.1ml
EUR 407
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to PE/ATTO 594.

Antibody for Human DUSP6

SPC-1126D-PCP 0.1ml
EUR 399
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to PerCP.

Antibody for Human DUSP6

SPC-1126D-RPE 0.1ml
EUR 397
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to RPE .

Antibody for Human DUSP6

SPC-1126D-STR 0.1ml
EUR 398
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Streptavidin.

Antibody for Human DUSP6

SPC-1127D 0.1ml
EUR 354
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is unconjugated.

Antibody for Human DUSP6

SPC-1127D-A390 0.1ml
EUR 401
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 390.

Antibody for Human DUSP6

SPC-1127D-A488 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 488.

Antibody for Human DUSP6

SPC-1127D-A565 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 565.

Antibody for Human DUSP6

SPC-1127D-A594 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 594.

Antibody for Human DUSP6

SPC-1127D-A633 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 633.

Antibody for Human DUSP6

SPC-1127D-A655 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 655.

Antibody for Human DUSP6

SPC-1127D-A680 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 680.

Antibody for Human DUSP6

SPC-1127D-A700 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 700.

Antibody for Human DUSP6

SPC-1127D-ALP 0.1ml
EUR 394
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human DUSP6

SPC-1127D-APC 0.1ml
EUR 399
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to APC .

Antibody for Human DUSP6

SPC-1127D-APCCY7 0.1ml
EUR 471
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to APC/Cy7.

Antibody for Human DUSP6

SPC-1127D-BI 0.1ml
EUR 396
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Biotin.

Antibody for Human DUSP6

SPC-1127D-DY350 0.1ml
EUR 475
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 350.

Antibody for Human DUSP6

SPC-1127D-DY405 0.1ml
EUR 452
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 405.

Antibody for Human DUSP6

SPC-1127D-DY488 0.1ml
EUR 432
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 488.

Antibody for Human DUSP6

SPC-1127D-DY594 0.1ml
EUR 436
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 594.

Antibody for Human DUSP6

SPC-1127D-DY633 0.1ml
EUR 426
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 633.

Antibody for Human DUSP6

SPC-1127D-FITC 0.1ml
EUR 392
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to FITC.

Antibody for Human DUSP6

SPC-1127D-HRP 0.1ml
EUR 388
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to HRP.

Antibody for Human DUSP6

SPC-1127D-P594 0.1ml
EUR 407
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to PE/ATTO 594.

Antibody for Human DUSP6

SPC-1127D-PCP 0.1ml
EUR 399
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to PerCP.

Antibody for Human DUSP6

SPC-1127D-RPE 0.1ml
EUR 397
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to RPE .

Antibody for Human DUSP6

SPC-1127D-STR 0.1ml
EUR 398
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Streptavidin.

Anti-DUSP6 / MKP3 antibody

STJ72927 100 µg
EUR 359

DUSP6 Blocking Peptide

DF2919-BP 1mg
EUR 195

DUSP6 Blocking Peptide

DF6284-BP 1mg
EUR 195

DUSP6 Blocking Peptide

DF7228-BP 1mg
EUR 195

DUSP6 Blocking Peptide

  • EUR 606.00
  • EUR 1428.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

DUSP6 cloning plasmid

CSB-CL621973HU1-10ug 10ug
EUR 430
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1146
  • Sequence: atgatagatacgctcagacccgtgcccttcgcgtcggaaatggcgatcagcaagacggtggcgtggctcaacgagcagctggagctgggcaacgagcggctgctgctgatggactgccggccgcaggagctatacgagtcgtcgcacatcgagtcggccatcaacgtggccatcc
  • Show more
Description: A cloning plasmid for the DUSP6 gene.

DUSP6 cloning plasmid

CSB-CL621973HU2-10ug 10ug
EUR 430
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1146
  • Sequence: atgatagatacgctcagacccgtgcccttcgcgtcggaaatggcgatcagcaagacggtggcgtggctcaacgagcagctggagctgggcaacgagcggctgctgctgatggactgccggccgcaggagctatacgagtcgtcgcacatcgagtcggccatcaacgtggccatcc
  • Show more
Description: A cloning plasmid for the DUSP6 gene.

anti-DUSP6 (3G2)

LF-MA10089 100 ug
EUR 363
Description: Mouse monoclonal to DUSP6

pT7- His- Dusp6

PVT10145 2 ug
EUR 301

Anti-DUSP6 (3G2)

YF-MA12752 200 ul
EUR 363
Description: Mouse monoclonal to DUSP6

Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DUSP6 (Met1~Ser300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6)

Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DUSP6 (Met1~Ser300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with APC.

Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DUSP6 (Met1~Ser300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with Biotin.

Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DUSP6 (Met1~Ser300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with Cy3.

Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DUSP6 (Met1~Ser300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with FITC.

Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DUSP6 (Met1~Ser300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with HRP.

Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DUSP6 (Met1~Ser300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with PE.

Dual Specificity Phosphatase 6 (DUSP6) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody

  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody

abx036164-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

DUSP6 Rabbit Polyclonal Antibody