CREB3 Rabbit Polyclonal Antibody

CREB3 Polyclonal Antibody

ES8521-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CREB3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CREB3 Polyclonal Antibody

ES8521-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CREB3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CREB3 Rabbit pAb

A13579-100ul 100 ul
EUR 308

CREB3 Rabbit pAb

A13579-200ul 200 ul
EUR 459

CREB3 Rabbit pAb

A13579-20ul 20 ul
EUR 183

CREB3 Rabbit pAb

A13579-50ul 50 ul
EUR 223

CREB3 Rabbit pAb

A6567-100ul 100 ul
EUR 308

CREB3 Rabbit pAb

A6567-200ul 200 ul
EUR 459

CREB3 Rabbit pAb

A6567-20ul 20 ul
EUR 183

CREB3 Rabbit pAb

A6567-50ul 50 ul
EUR 223

CREB3 antibody

70R-16581 50 ul
EUR 435
Description: Rabbit polyclonal CREB3 antibody

CREB3 antibody

39013-100ul 100ul
EUR 252

CREB3 antibody

10R-1626 100 ug
EUR 512
Description: Mouse monoclonal CREB3 antibody

CREB3 Antibody

1-CSB-PA005948ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity purified
Description: A polyclonal antibody against CREB3. Recognizes CREB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:1000, IHC:1:20-200

CREB3 Antibody

1-CSB-PA005948GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CREB3. Recognizes CREB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal CREB3 Antibody (C-term)

APR11046G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CREB3 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal CREB3 Antibody (N-term)

AMM05358G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CREB3 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal CREB3 / LZIP Antibody (aa76-87)

APR11045G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CREB3 / LZIP (aa76-87). This antibody is tested and proven to work in the following applications:

Anti-CREB3 Antibody

A03564-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CREB3 Antibody (CREB3) detection. Tested with WB in Human, Mouse, Rat.

CREB3 Conjugated Antibody

C39013 100ul
EUR 397

anti- CREB3 antibody

FNab01962 100µg
EUR 505.25
  • Immunogen: cAMP responsive element binding protein 3
  • Uniprot ID: O43889
  • Gene ID: 10488
  • Research Area: Immunology, Metabolism
Description: Antibody raised against CREB3

Anti-CREB3 antibody

PAab01962 100 ug
EUR 355

Anti-CREB3 antibody

STJ28650 100 µl
EUR 277
Description: This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds to the cAMP-response element and regulates cell proliferation. The protein interacts with host cell factor C1, which also associates with the herpes simplex virus (HSV) protein VP16 that induces transcription of HSV immediate-early genes. This protein and VP16 both bind to the same site on host cell factor C1. It is thought that the interaction between this protein and host cell factor C1 plays a role in the establishment of latency during HSV infection. This protein also plays a role in leukocyte migration, tumor suppression, and endoplasmic reticulum stress-associated protein degradation. Additional transcript variants have been identified, but their biological validity has not been determined.

Anti-CREB3 antibody

STJ115540 100 µl
EUR 277
Description: This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds to the cAMP-response element and regulates cell proliferation. The protein interacts with host cell factor C1, which also associates with the herpes simplex virus (HSV) protein VP16 that induces transcription of HSV immediate-early genes. This protein and VP16 both bind to the same site on host cell factor C1. It is thought that the interaction between this protein and host cell factor C1 plays a role in the establishment of latency during HSV infection. This protein also plays a role in leukocyte migration, tumor suppression, and endoplasmic reticulum stress-associated protein degradation. Additional transcript variants have been identified, but their biological validity has not been determined.

Anti-CREB3 antibody

STJ98634 200 µl
EUR 197
Description: Rabbit polyclonal to CREB3.

Polyclonal CREB3 (aa76-87) Antibody (internal region)

APR11044G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CREB3 (aa76-87) (internal region). This antibody is tested and proven to work in the following applications:

CREB3 siRNA

20-abx912771
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CREB3

YF-PA17002 100 ug
EUR 403
Description: Rabbit polyclonal to CREB3

anti-CREB3

YF-PA25589 50 ul
EUR 334
Description: Mouse polyclonal to CREB3

CREB3 cloning plasmid

CSB-CL005948HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1116
  • Sequence: atggagctggaattggatgctggtgaccaagacctgctggccttcctgctagaggaaagtggagatttggggacggcacccgatgaggccgtgagggccccactggactgggcgctgccgctttctgaggtaccgagcgactgggaagtagatgatttgctgtgctccctgctga
  • Show more
Description: A cloning plasmid for the CREB3 gene.

CREB3 cloning plasmid

CSB-CL005948HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1116
  • Sequence: atggagctggaattggatgctggtgaccaagacctgctggccttcctgctagaggaaagtggagatttggggacggcacccgatgaggccgtgagggccccactggactgggcgctgccgctttctgaggtaccgagcgactgggaagtagatgatttgctgtgctccctgctga
  • Show more
Description: A cloning plasmid for the CREB3 gene.

Anti-CREB3 (3H5)

YF-MA11292 100 ug
EUR 363
Description: Mouse monoclonal to CREB3

Anti-CREB3 (aa76-87) antibody

STJ73025 100 µg
EUR 359

Bovine CREB3 ELISA KIT

ELI-10455b 96 Tests
EUR 928

Mouse Creb3 ELISA KIT

ELI-26119m 96 Tests
EUR 865

CREB3 ELISA KIT|Human

EF008836 96 Tests
EUR 689

Human CREB3 shRNA Plasmid

20-abx957125
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CREB3 ELISA KIT

ELI-50475h 96 Tests
EUR 824

CREB3 Recombinant Protein (Human)

RP007975 100 ug Ask for price

CREB3 Recombinant Protein (Human)

RP007978 100 ug Ask for price

CREB3 Recombinant Protein (Rat)

RP196241 100 ug Ask for price

CREB3 Rabbit Polyclonal Antibody