CMTM8 Rabbit Polyclonal Antibody

CMTM8 Polyclonal Antibody

ES8424-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CMTM8 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CMTM8 Polyclonal Antibody

ES8424-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CMTM8 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CMTM8 Antibody

36887-100ul 100ul
EUR 252

CMTM8 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CMTM8. Recognizes CMTM8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

CMTM8 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CMTM8. Recognizes CMTM8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

CMTM8 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CMTM8. Recognizes CMTM8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

CMTM8 antibody

70R-6363 50 ug
EUR 467
Description: Rabbit polyclonal CMTM8 antibody raised against the middle region of CMTM8

Polyclonal CMTM8 antibody - middle region

APR15525G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CMTM8 - middle region. This antibody is tested and proven to work in the following applications:

CMTM8 Polyclonal Antibody, HRP Conjugated

A66055 100 µg
EUR 570.55
Description: Ask the seller for details

CMTM8 Polyclonal Antibody, FITC Conjugated

A66056 100 µg
EUR 570.55
Description: The best epigenetics products

CMTM8 Polyclonal Antibody, Biotin Conjugated

A66057 100 µg
EUR 570.55
Description: kits suitable for this type of research

CMTM8 Conjugated Antibody

C36887 100ul
EUR 397

anti- CMTM8 antibody

FNab01788 100µg
EUR 548.75
  • Immunogen: CKLF-like MARVEL transmembrane domain containing 8
  • Uniprot ID: Q8IZV2
  • Gene ID: 152189
  • Research Area: Signal Transduction
Description: Antibody raised against CMTM8

Anti-CMTM8 antibody

PAab01788 100 ug
EUR 386

Anti-CMTM8 antibody

STJ97681 200 µl
EUR 197
Description: Rabbit polyclonal to CMTM8.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-CMTM8/Cklfsf8 Antibody

A11789 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CMTM8 Antibody (CMTM8) detection.tested for IHC, WB in Human.

CMTM8 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CMTM8. Recognizes CMTM8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CMTM8 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CMTM8. Recognizes CMTM8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CMTM8 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CMTM8. Recognizes CMTM8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CMTM8 Blocking Peptide

33R-1686 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CMTM8 antibody, catalog no. 70R-6363

CMTM8 Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CMTM8 cloning plasmid

CSB-CL809032HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 522
  • Sequence: atggaggagccgcagcgcgcccgctcgcacacagtcaccaccaccgccagctccttcgcagagaacttctccaccagcagcagcagcttcgcctacgaccgggagttcctccgcaccctgcacggcttcctcatcgtggccgagatcgttctggggctgctggtatggacgcttat
  • Show more
Description: A cloning plasmid for the CMTM8 gene.


ELI-10632b 96 Tests
EUR 928


EF008747 96 Tests
EUR 689

Mouse CMTM8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CMTM8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-33463h 96 Tests
EUR 824

Mouse Cmtm8 ELISA KIT

ELI-50659m 96 Tests
EUR 865

CMTM8 Recombinant Protein (Human)

RP007462 100 ug Ask for price

CMTM8 Recombinant Protein (Rat)

RP195551 100 ug Ask for price

CMTM8 Recombinant Protein (Mouse)

RP124931 100 ug Ask for price

Cmtm8 ORF Vector (Rat) (pORF)

ORF065185 1.0 ug DNA
EUR 506

CMTM8 ORF Vector (Human) (pORF)

ORF002488 1.0 ug DNA
EUR 95

Cmtm8 ORF Vector (Mouse) (pORF)

ORF041645 1.0 ug DNA
EUR 506

CMTM8 ELISA Kit (Human) (OKEI00159)

OKEI00159 96 Wells
EUR 767
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

CMTM8 ELISA Kit (Mouse) (OKEI00409)

OKEI00409 96 Wells
EUR 767
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

Rabbit CKLF Like MARVEL Transmembrane Domain Containing 8 (CMTM8) ELISA Kit

abx362984-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

CMTM8 sgRNA CRISPR Lentivector set (Human)

K0473301 3 x 1.0 ug
EUR 339

Cmtm8 sgRNA CRISPR Lentivector set (Rat)

K7264301 3 x 1.0 ug
EUR 339

Cmtm8 sgRNA CRISPR Lentivector set (Mouse)

K3488701 3 x 1.0 ug
EUR 339

Rabbit CKLF like MARVEL transmembrane domain containing protein 8(CMTM8) ELISA kit

E04C1838-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CKLF like MARVEL transmembrane domain containing protein 8(CMTM8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CKLF like MARVEL transmembrane domain containing protein 8(CMTM8) ELISA kit

E04C1838-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CKLF like MARVEL transmembrane domain containing protein 8(CMTM8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CKLF like MARVEL transmembrane domain containing protein 8(CMTM8) ELISA kit

E04C1838-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CKLF like MARVEL transmembrane domain containing protein 8(CMTM8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CKLF-Like MARVEL Transmembrane Domain Containing 8 (CMTM8) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

CKLF-Like MARVEL Transmembrane Domain Containing 8 (CMTM8) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

CKLF Like MARVEL Transmembrane Domain Containing 8 (CMTM8) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

CKLF Like MARVEL Transmembrane Domain Containing 8 (CMTM8) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CKLF Like MARVEL Transmembrane Domain Containing 8 (CMTM8) Antibody

abx231788-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

CMTM8 sgRNA CRISPR Lentivector (Human) (Target 1)

K0473302 1.0 ug DNA
EUR 154

CMTM8 sgRNA CRISPR Lentivector (Human) (Target 2)

K0473303 1.0 ug DNA
EUR 154

CMTM8 sgRNA CRISPR Lentivector (Human) (Target 3)

K0473304 1.0 ug DNA
EUR 154

Cmtm8 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7264302 1.0 ug DNA
EUR 154

Cmtm8 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7264303 1.0 ug DNA
EUR 154

Cmtm8 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7264304 1.0 ug DNA
EUR 154

Cmtm8 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3488702 1.0 ug DNA
EUR 154

Cmtm8 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3488703 1.0 ug DNA
EUR 154

Cmtm8 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3488704 1.0 ug DNA
EUR 154

CMTM8 Protein Vector (Mouse) (pPB-C-His)

PV166578 500 ng
EUR 603

CMTM8 Protein Vector (Mouse) (pPB-N-His)

PV166579 500 ng
EUR 603

CMTM8 Protein Vector (Mouse) (pPM-C-HA)

PV166580 500 ng
EUR 603

CMTM8 Protein Vector (Mouse) (pPM-C-His)

PV166581 500 ng
EUR 603

CMTM8 Protein Vector (Rat) (pPB-C-His)

PV260738 500 ng
EUR 603

CMTM8 Protein Vector (Rat) (pPB-N-His)

PV260739 500 ng
EUR 603

CMTM8 Protein Vector (Rat) (pPM-C-HA)

PV260740 500 ng
EUR 603

CMTM8 Protein Vector (Rat) (pPM-C-His)

PV260741 500 ng
EUR 603

CMTM8 Protein Vector (Human) (pPB-C-His)

PV009949 500 ng
EUR 329

CMTM8 Protein Vector (Human) (pPB-N-His)

PV009950 500 ng
EUR 329

CMTM8 Protein Vector (Human) (pPM-C-HA)

PV009951 500 ng
EUR 329

CMTM8 Protein Vector (Human) (pPM-C-His)

PV009952 500 ng
EUR 329

Cmtm8 3'UTR GFP Stable Cell Line

TU154082 1.0 ml Ask for price

Cmtm8 3'UTR Luciferase Stable Cell Line

TU104082 1.0 ml Ask for price

Cmtm8 3'UTR Luciferase Stable Cell Line

TU202529 1.0 ml Ask for price

Cmtm8 3'UTR GFP Stable Cell Line

TU252529 1.0 ml Ask for price

CMTM8 3'UTR GFP Stable Cell Line

TU054665 1.0 ml
EUR 1394

CMTM8 3'UTR Luciferase Stable Cell Line

TU004665 1.0 ml
EUR 1394

CKLF Like MARVEL Transmembrane Domain Containing 8 (CMTM8) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CKLF Like MARVEL Transmembrane Domain Containing 8 (CMTM8) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CKLF Like MARVEL Transmembrane Domain Containing 8 (CMTM8) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CMTM8 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV631069 1.0 ug DNA
EUR 514

CMTM8 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV631073 1.0 ug DNA
EUR 514

CMTM8 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV631074 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

CMTM8 Rabbit Polyclonal Antibody