CLIC1 Rabbit Polyclonal Antibody

CLIC1 Polyclonal Antibody

ABP57313-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CLIC1 from Human, Mouse, Rat. This CLIC1 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

CLIC1 Polyclonal Antibody

ABP57313-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CLIC1 from Human, Mouse, Rat. This CLIC1 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

CLIC1 Polyclonal Antibody

ES8306-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CLIC1 from Human/Mouse/Rat. This antibody is tested and validated for IHC

CLIC1 Polyclonal Antibody

ES8306-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CLIC1 from Human/Mouse/Rat. This antibody is tested and validated for IHC

CLIC1 Rabbit pAb

A13684-100ul 100 ul
EUR 308

CLIC1 Rabbit pAb

A13684-200ul 200 ul
EUR 459

CLIC1 Rabbit pAb

A13684-20ul 20 ul
EUR 183

CLIC1 Rabbit pAb

A13684-50ul 50 ul
EUR 223

CLIC1 Rabbit pAb

A6363-100ul 100 ul
EUR 308

CLIC1 Rabbit pAb

A6363-200ul 200 ul
EUR 459

CLIC1 Rabbit pAb

A6363-20ul 20 ul
EUR 183

CLIC1 Rabbit pAb

A6363-50ul 50 ul
EUR 223

Polyclonal CLIC1 Antibody (Center)

APG02649G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CLIC1 (Center). This antibody is tested and proven to work in the following applications:

Human Chloride Intracellular Channel Protein 1 (CLIC1) ELISA Kit

DLR-CLIC1-Hu-48T 48T
EUR 517
  • Should the Human Chloride Intracellular Channel Protein 1 (CLIC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chloride Intracellular Channel Protein 1 (CLIC1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Chloride Intracellular Channel Protein 1 (CLIC1) ELISA Kit

DLR-CLIC1-Hu-96T 96T
EUR 673
  • Should the Human Chloride Intracellular Channel Protein 1 (CLIC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chloride Intracellular Channel Protein 1 (CLIC1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Chloride Intracellular Channel Protein 1 (CLIC1) ELISA Kit

RDR-CLIC1-Hu-48Tests 48 Tests
EUR 544

Human Chloride Intracellular Channel Protein 1 (CLIC1) ELISA Kit

RDR-CLIC1-Hu-96Tests 96 Tests
EUR 756

Human Chloride Intracellular Channel Protein 1 (CLIC1) ELISA Kit

RD-CLIC1-Hu-48Tests 48 Tests
EUR 521

Human Chloride Intracellular Channel Protein 1 (CLIC1) ELISA Kit

RD-CLIC1-Hu-96Tests 96 Tests
EUR 723

CLIC1 antibody

70R-16451 50 ul
EUR 435
Description: Rabbit polyclonal CLIC1 antibody

CLIC1 antibody

70R-1487 100 ug
EUR 377
Description: Rabbit polyclonal CLIC1 antibody raised against the N terminal of CLIC1

CLIC1 antibody

70R-1489 100 ug
EUR 377
Description: Rabbit polyclonal CLIC1 antibody raised against the C terminal of CLIC1

CLIC1 Antibody

36633-100ul 100ul
EUR 252

CLIC1 antibody

38848-100ul 100ul
EUR 252

CLIC1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CLIC1. Recognizes CLIC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

CLIC1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CLIC1. Recognizes CLIC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF

CLIC1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CLIC1. Recognizes CLIC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

CLIC1 antibody

70R-5044 50 ug
EUR 467
Description: Rabbit polyclonal CLIC1 antibody raised against the C terminal of CLIC1

Polyclonal CLIC1 / NCC27 Antibody (internal region)

APG02646G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CLIC1 / NCC27 (internal region). This antibody is tested and proven to work in the following applications:

CLIC1 Conjugated Antibody

C36633 100ul
EUR 397

CLIC1 Conjugated Antibody

C38848 100ul
EUR 397

anti- CLIC1 antibody

FNab01759 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:10 - 1:100
  • Immunogen: chloride intracellular channel 1
  • Uniprot ID: O00299
  • Gene ID: 1192
  • Research Area: Signal Transduction
Description: Antibody raised against CLIC1

Anti-CLIC1 antibody

PAab01759 100 ug
EUR 355

Anti-CLIC1 antibody

STJ28446 100 µl
EUR 277
Description: Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 1 is a member of the p64 family; the protein localizes principally to the cell nucleus and exhibits both nuclear and plasma membrane chloride ion channel activity.

Anti-CLIC1 antibody

STJ115639 100 µl
EUR 277
Description: Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 1 is a member of the p64 family; the protein localizes principally to the cell nucleus and exhibits both nuclear and plasma membrane chloride ion channel activity.

Anti-CLIC1 antibody

STJ97560 200 µl
EUR 197
Description: Rabbit polyclonal to CLIC1 (A216).

Clic1/ Rat Clic1 ELISA Kit

ELI-25923r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA10981 50 ul
EUR 363
Description: Mouse polyclonal to CLIC1


YF-PA10982 50 ug
EUR 363
Description: Mouse polyclonal to CLIC1


YF-PA23472 50 ul
EUR 334
Description: Mouse polyclonal to CLIC1

Anti-CLIC1 / NCC27 antibody

STJ73390 100 µg
EUR 359

Polyclonal CLIC1 / NCC27 (aa45-57) Antibody (internal region)

APG02633G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CLIC1 / NCC27 (aa45-57) (internal region). This antibody is tested and proven to work in the following applications:

CLIC1 Blocking Peptide

33R-3502 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CLIon Channel1 antibody, catalog no. 70R-1487

CLIC1 Blocking Peptide

33R-5478 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CLIon Channel1 antibody, catalog no. 70R-1489

CLIC1 cloning plasmid

CSB-CL005545HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 726
  • Sequence: atggctgaagaacaaccgcaggtcgaattgttcgtgaaggctggcagtgatggggccaagattgggaactgcccattctcccagagactgttcatggtactgtggctcaagggagtcaccttcaatgttaccaccgttgacaccaaaaggcggaccgagacagtgcagaagctgtg
  • Show more
Description: A cloning plasmid for the CLIC1 gene.

Anti-CLIC1 (2D4)

YF-MA10167 100 ug
EUR 363
Description: Mouse monoclonal to CLIC1

Anti-CLIC1 (2D4)

YF-MA10168 50 ug
EUR 363
Description: Mouse monoclonal to CLIC1

Anti-CLIC1 (3F9)

YF-MA10169 100 ug
EUR 363
Description: Mouse monoclonal to CLIC1

Anti-CLIC1 (2D4)

YF-MA12475 200 ul
EUR 363
Description: Mouse monoclonal to CLIC1

Chloride Intracellular Channel Protein 1 (CLIC1) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC1 (Lys79~Lys241)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 1 (CLIC1)

Anti-CLIC1 / NCC27 (aa45-57) antibody

STJ73389 100 µg
EUR 359

Chloride Intracellular Channel Protein 1 (CLIC1) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC1 (Lys79~Lys241)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 1 (CLIC1). This antibody is labeled with APC.

Chloride Intracellular Channel Protein 1 (CLIC1) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC1 (Lys79~Lys241)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 1 (CLIC1). This antibody is labeled with Biotin.

Chloride Intracellular Channel Protein 1 (CLIC1) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC1 (Lys79~Lys241)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 1 (CLIC1). This antibody is labeled with Cy3.

Chloride Intracellular Channel Protein 1 (CLIC1) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC1 (Lys79~Lys241)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 1 (CLIC1). This antibody is labeled with FITC.

Chloride Intracellular Channel Protein 1 (CLIC1) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC1 (Lys79~Lys241)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 1 (CLIC1). This antibody is labeled with HRP.

Chloride Intracellular Channel Protein 1 (CLIC1) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC1 (Lys79~Lys241)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 1 (CLIC1). This antibody is labeled with PE.

CLIC1 protein (His tag)

80R-1332 100 ug
EUR 268
Description: Purified recombinant Human CLIC1 protein


EF008722 96 Tests
EUR 689

Rat CLIC1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CLIC1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CLIC1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CLIC1 Recombinant Protein (Human)

RP007327 100 ug Ask for price

CLIC1 Recombinant Protein (Rat)

RP195353 100 ug Ask for price

CLIC1 Recombinant Protein (Mouse)

RP124691 100 ug Ask for price

Rabbit Chloride intracellular channel protein 1(CLIC1) ELISA kit

E04C1791-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chloride intracellular channel protein 1(CLIC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chloride intracellular channel protein 1(CLIC1) ELISA kit

E04C1791-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chloride intracellular channel protein 1(CLIC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chloride intracellular channel protein 1(CLIC1) ELISA kit

E04C1791-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chloride intracellular channel protein 1(CLIC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chloride intracellular channel protein 1, CLIC1 ELISA KIT

ELI-33819Ra 96 Tests
EUR 928

Chloride Intracellular Channel Protein 1 (CLIC1) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC1 (Lys79~Lys241)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 1 (CLIC1). This antibody is labeled with APC-Cy7.

Chloride Intracellular Channel Protein 1 (CLIC1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 1 (CLIC1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 1 (CLIC1) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Chloride Intracellular Channel Protein 1 (CLIC1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 1 (CLIC1) Antibody

abx034942-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 1 (CLIC1) Antibody

abx034942-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 1 (CLIC1) Antibody

abx038391-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 1 (CLIC1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Chloride Intracellular Channel Protein 1 (CLIC1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 1 (CLIC1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Chloride Intracellular Channel Protein 1 (CLIC1) Antibody

abx033496-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 1 (CLIC1) Antibody

abx033496-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 1 (CLIC1) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 1 (CLIC1) Antibody

abx430324-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Chloride Intracellular Channel Protein 1 (CLIC1) Antibody

abx430325-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Chloride Intracellular Channel Protein 1 (CLIC1) Antibody

abx231759-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Clic1 ORF Vector (Rat) (pORF)

ORF065119 1.0 ug DNA
EUR 506

CLIC1 ORF Vector (Human) (pORF)

ORF002443 1.0 ug DNA
EUR 95

Clic1 ORF Vector (Mouse) (pORF)

ORF041565 1.0 ug DNA
EUR 506

Monoclonal CLIC1 / NCC27 Antibody (clone 2D4), Clone: 2D4

APG02634G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human CLIC1 / NCC27 (clone 2D4). The antibodies are raised in Mouse and are from clone 2D4. This antibody is applicable in WB and IHC-P, E

Monoclonal CLIC1 / NCC27 Antibody (clone 3F9), Clone: 3F9

APG02645G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human CLIC1 / NCC27 (clone 3F9). The antibodies are raised in Mouse and are from clone 3F9. This antibody is applicable in WB and IHC-P, E

CLIC1 sgRNA CRISPR Lentivector set (Human)

K0464601 3 x 1.0 ug
EUR 339

Clic1 sgRNA CRISPR Lentivector set (Mouse)

K4958901 3 x 1.0 ug
EUR 339

Clic1 sgRNA CRISPR Lentivector set (Rat)

K7199401 3 x 1.0 ug
EUR 339

CLIC1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0464602 1.0 ug DNA
EUR 154

CLIC1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0464603 1.0 ug DNA
EUR 154

CLIC1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0464604 1.0 ug DNA
EUR 154

Clic1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4958902 1.0 ug DNA
EUR 154

Clic1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4958903 1.0 ug DNA
EUR 154

Clic1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4958904 1.0 ug DNA
EUR 154

Clic1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7199402 1.0 ug DNA
EUR 154

CLIC1 Rabbit Polyclonal Antibody