CHID1 Rabbit Polyclonal Antibody

CHID1 Polyclonal Antibody

ABP57556-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic peptide from human protein at AA range: 81-130
  • Applications tips:
Description: A polyclonal antibody for detection of CHID1 from Human, Mouse, Rat. This CHID1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 81-130

CHID1 Polyclonal Antibody

ABP57556-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 81-130
  • Applications tips:
Description: A polyclonal antibody for detection of CHID1 from Human, Mouse, Rat. This CHID1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 81-130

CHID1 Polyclonal Antibody

A58554 100 µg
EUR 570.55
Description: The best epigenetics products

CHID1 Polyclonal Antibody

29746-100ul 100ul
EUR 252

CHID1 Polyclonal Antibody

29746-50ul 50ul
EUR 187

CHID1 Rabbit pAb

A16142-100ul 100 ul
EUR 308

CHID1 Rabbit pAb

A16142-200ul 200 ul
EUR 459

CHID1 Rabbit pAb

A16142-20ul 20 ul
EUR 183

CHID1 Rabbit pAb

A16142-50ul 50 ul
EUR 223

CHID1 Polyclonal Conjugated Antibody

C29746 100ul
EUR 397

CHID1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CHID1. Recognizes CHID1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

CHID1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against CHID1. Recognizes CHID1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000ELISA:1:10000

CHID1 Polyclonal Antibody, Biotin Conjugated

A58555 100 µg
EUR 570.55
Description: kits suitable for this type of research

CHID1 Polyclonal Antibody, FITC Conjugated

A58556 100 µg
EUR 570.55
Description: fast delivery possible

CHID1 Polyclonal Antibody, HRP Conjugated

A58557 100 µg
EUR 570.55
Description: reagents widely cited

Anti-CHID1 antibody

STJ98662 200 µl
EUR 197
Description: Rabbit polyclonal to CHID1.

Anti-CHID1 antibody

STJ118595 100 µl
EUR 277

Chid1/ Rat Chid1 ELISA Kit

ELI-10640r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CHID1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CHID1. Recognizes CHID1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CHID1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CHID1. Recognizes CHID1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CHID1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CHID1. Recognizes CHID1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CHID1 cloning plasmid

CSB-CL883614HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1182
  • Sequence: atgcggacactcttcaacctcctctggcttgccctggcctgcagccctgttcacactaccctgtcaaagtcagatgccaaaaaagccgcctcaaagacgctgctggagaagagtcagttttcagataagccggtgcaagaccggggtttggtggtgacggacctcaaagctgaga
  • Show more
Description: A cloning plasmid for the CHID1 gene.

pENTR223-CHID1 vector

PVT12138 2 ug
EUR 308

Anti-CHID1/Si Clp Antibody

A10376 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CHID1 Antibody (CHID1) detection. Tested with WB in Human, Mouse, Rat.

Mouse CHID1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat CHID1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELA-E9891h 96 Tests
EUR 824


EF006558 96 Tests
EUR 689

Human CHID1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CHID1 Recombinant Protein (Human)

RP007000 100 ug Ask for price


PVT12762 2 ug
EUR 703

CHID1 Recombinant Protein (Rat)

RP194840 100 ug Ask for price

CHID1 Recombinant Protein (Mouse)

RP123923 100 ug Ask for price

CHID1 Recombinant Protein (Mouse)

RP123926 100 ug Ask for price

Rabbit Chitinase domain containing protein 1(CHID1) ELISA kit

E04C1679-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chitinase domain containing protein 1(CHID1) ELISA kit

E04C1679-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chitinase domain containing protein 1(CHID1) ELISA kit

E04C1679-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Chitinase Domain-Containing Protein 1 (CHID1) Antibody

abx029311-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Chitinase Domain-Containing Protein 1 (CHID1) Antibody

abx029311-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Chitinase Domain-Containing Protein 1 (CHID1) Antibody

abx340044-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Chitinase Domain-Containing Protein 1 (CHID1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chitinase Domain-Containing Protein 1 (CHID1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CHID1 ORF Vector (Human) (pORF)

ORF002334 1.0 ug DNA
EUR 95

Chid1 ORF Vector (Rat) (pORF)

ORF064948 1.0 ug DNA
EUR 506

Chid1 ORF Vector (Mouse) (pORF)

ORF041309 1.0 ug DNA
EUR 506

Chid1 ORF Vector (Mouse) (pORF)

ORF041310 1.0 ug DNA
EUR 506

CHID1 ELISA Kit (Human) (OKEH02028)

OKEH02028 96 Wells
EUR 727
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.12 ng/mL

Chitinase Domain-Containing Protein 1 (CHID1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chitinase Domain-Containing Protein 1 (CHID1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chitinase Domain-Containing Protein 1 (CHID1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CHID1 sgRNA CRISPR Lentivector set (Human)

K0445101 3 x 1.0 ug
EUR 339

Chid1 sgRNA CRISPR Lentivector set (Rat)

K7418701 3 x 1.0 ug
EUR 339

Chid1 sgRNA CRISPR Lentivector set (Mouse)

K3537201 3 x 1.0 ug
EUR 339

CHID1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0445102 1.0 ug DNA
EUR 154

CHID1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0445103 1.0 ug DNA
EUR 154

CHID1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0445104 1.0 ug DNA
EUR 154

Human Chitinase domain-containing protein 1 (CHID1)

  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 44.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Chitinase domain-containing protein 1(CHID1) expressed in Yeast

Human Chitinase domain-containing protein 1 (CHID1)

  • EUR 293.00
  • EUR 963.00
  • EUR 409.00
  • EUR 717.00
  • 100ug
  • 1MG
  • 200ug
  • 500ug
  • MW: 46.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Chitinase domain-containing protein 1(CHID1) expressed in Mammalian cell

Human Chitinase domain-containing protein 1 (CHID1)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 46.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Chitinase domain-containing protein 1(CHID1) expressed in E.coli

Mouse Chitinase domain-containing protein 1 (Chid1)

  • EUR 761.00
  • EUR 306.00
  • EUR 1951.00
  • EUR 1026.00
  • EUR 1422.00
  • EUR 431.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 44.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Chitinase domain-containing protein 1(Chid1) ,partial expressed in Baculovirus

Chid1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7418702 1.0 ug DNA
EUR 154

Chid1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7418703 1.0 ug DNA
EUR 154

Chid1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7418704 1.0 ug DNA
EUR 154

Chid1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3537202 1.0 ug DNA
EUR 154

Chid1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3537203 1.0 ug DNA
EUR 154

Chid1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3537204 1.0 ug DNA
EUR 154

CHID1 Rabbit Polyclonal Antibody