CEP57 Rabbit Polyclonal Antibody

CEP57 Polyclonal Antibody

ES8087-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CEP57 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CEP57 Polyclonal Antibody

ABP57088-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human CEP57 at AA range: 210-290
  • Applications tips:
Description: A polyclonal antibody for detection of CEP57 from Human. This CEP57 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CEP57 at AA range: 210-290

CEP57 Polyclonal Antibody

ABP57088-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human CEP57 at AA range: 210-290
  • Applications tips:
Description: A polyclonal antibody for detection of CEP57 from Human. This CEP57 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CEP57 at AA range: 210-290

CEP57 Polyclonal Antibody

ABP57088-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human CEP57 at AA range: 210-290
  • Applications tips:
Description: A polyclonal antibody for detection of CEP57 from Human. This CEP57 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CEP57 at AA range: 210-290

CEP57 Rabbit pAb

A11818-100ul 100 ul
EUR 308

CEP57 Rabbit pAb

A11818-200ul 200 ul
EUR 459

CEP57 Rabbit pAb

A11818-20ul 20 ul Ask for price

CEP57 Rabbit pAb

A11818-50ul 50 ul Ask for price

CEP57 antibody

70R-50735 100 ul
EUR 244
Description: Purified Polyclonal CEP57 antibody

CEP57 antibody

70R-36224 100 ug
EUR 327
Description: Rabbit polyclonal CEP57 antibody

CEP57 Antibody

ABD3919 100 ug
EUR 438

CEP57 Antibody

34567-100ul 100ul
EUR 252

CEP57 Antibody

34567-50ul 50ul
EUR 187

CEP57 Antibody

46476-100ul 100ul
EUR 252

CEP57 Antibody

DF3919 200ul
EUR 304
Description: CEP57 Antibody detects endogenous levels of total CEP57.

CEP57 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CEP57. Recognizes CEP57 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CEP57 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CEP57. Recognizes CEP57 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CEP57 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CEP57. Recognizes CEP57 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

CEP57 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CEP57. Recognizes CEP57 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

CEP57 Antibody

CSB-PA095230-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CEP57. Recognizes CEP57 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Polyclonal CEP57 Antibody (N-term)

APR15407G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CEP57 (N-term). This antibody is tested and proven to work in the following applications:

CEP57 Conjugated Antibody

C46476 100ul
EUR 397

CEP57 Conjugated Antibody

C34567 100ul
EUR 397

Anti-CEP57 Antibody

A07898 100ul
EUR 397
Description: Rabbit Polyclonal CEP57 Antibody. Validated in WB and tested in Human.

Anti-CEP57 antibody

STJ92228 200 µl
EUR 197
Description: Rabbit polyclonal to CEP57.

Anti-CEP57 antibody

STJ113397 100 µl
EUR 277
Description: This gene encodes a cytoplasmic protein called Translokin. This protein localizes to the centrosome and has a function in microtubular stabilization. The N-terminal half of this protein is required for its centrosome localization and for its multimerization, and the C-terminal half is required for nucleating, bundling and anchoring microtubules to the centrosomes. This protein specifically interacts with fibroblast growth factor 2 (FGF2), sorting nexin 6, Ran-binding protein M and the kinesins KIF3A and KIF3B, and thus mediates the nuclear translocation and mitogenic activity of the FGF2. It also interacts with cyclin D1 and controls nucleocytoplasmic distribution of the cyclin D1 in quiescent cells. This protein is crucial for maintaining correct chromosomal number during cell division. Mutations in this gene cause mosaic variegated aneuploidy syndrome, a rare autosomal recessive disorder. Multiple alternatively spliced transcript variants encoding different isoforms have been identified.

Cep57/ Rat Cep57 ELISA Kit

ELI-10057r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA16486 50 ug
EUR 363
Description: Mouse polyclonal to CEP57


YF-PA16487 100 ul
EUR 403
Description: Rabbit polyclonal to CEP57


YF-PA16488 100 ug
EUR 403
Description: Rabbit polyclonal to CEP57

CEP57 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CEP57 Blocking Peptide

DF3919-BP 1mg
EUR 195

CEP57 cloning plasmid

CSB-CL769805HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 813
  • Sequence: atggcggcggcgtctgtctctgcggcttctggttctcacttgtcgaacagctttgctgagccatcaaggtctaatggaagcatggttcggcattcttcatctccatatgtagtatatccttcggataagcctttccttaatagtgatctacgacgctccccaagtaagcctacact
  • Show more
Description: A cloning plasmid for the CEP57 gene.


PVT12549 2 ug
EUR 391

Anti-CEP57 (1E9)

YF-MA16976 100 ug
EUR 363
Description: Mouse monoclonal to CEP57

Centrosomal Protein 57 (CEP57) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Centrosomal Protein 57 (CEP57) Antibody

abx330880-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Mouse CEP57 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat CEP57 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CEP57 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CEP57 Recombinant Protein (Human)

RP006790 100 ug Ask for price

CEP57 Recombinant Protein (Rat)

RP194588 100 ug Ask for price

CEP57 Recombinant Protein (Mouse)

RP123581 100 ug Ask for price

Centrosomal Protein 57 kDa (CEP57) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Centrosomal Protein 57 kDa (CEP57) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Centrosomal Protein 57 kDa (CEP57) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Centrosomal Protein 57 kDa (CEP57) Antibody

abx029257-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Centrosomal Protein 57 kDa (CEP57) Antibody

abx029257-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Centrosomal Protein 57 kDa (CEP57) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Centrosomal Protein 57 kDa (CEP57) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rabbit Centrosomal protein of 57 kDa(CEP57) ELISA kit

E04C0954-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Centrosomal protein of 57 kDa(CEP57) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Centrosomal protein of 57 kDa(CEP57) ELISA kit

E04C0954-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Centrosomal protein of 57 kDa(CEP57) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Centrosomal protein of 57 kDa(CEP57) ELISA kit

E04C0954-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Centrosomal protein of 57 kDa(CEP57) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CEP57 ORF Vector (Human) (pORF)

ORF002264 1.0 ug DNA
EUR 95

Cep57 ORF Vector (Mouse) (pORF)

ORF041195 1.0 ug DNA
EUR 506

Cep57 ORF Vector (Rat) (pORF)

ORF064864 1.0 ug DNA
EUR 506

Recombinant Centrosomal Protein 57kDa (CEP57)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q86XR8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 47.7kDa
  • Isoelectric Point: 9
Description: Recombinant Human Centrosomal Protein 57kDa expressed in: E.coli

Recombinant Centrosomal Protein 57kDa (CEP57)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.3kDa
  • Isoelectric Point: 8.5
Description: Recombinant Mouse Centrosomal Protein 57kDa expressed in: E.coli

CEP57 sgRNA CRISPR Lentivector set (Human)

K0433501 3 x 1.0 ug
EUR 339

Cep57 sgRNA CRISPR Lentivector set (Mouse)

K4880201 3 x 1.0 ug
EUR 339

Cep57 sgRNA CRISPR Lentivector set (Rat)

K6671101 3 x 1.0 ug
EUR 339

CEP57 sgRNA CRISPR Lentivector (Human) (Target 1)

K0433502 1.0 ug DNA
EUR 154

CEP57 sgRNA CRISPR Lentivector (Human) (Target 2)

K0433503 1.0 ug DNA
EUR 154

CEP57 sgRNA CRISPR Lentivector (Human) (Target 3)

K0433504 1.0 ug DNA
EUR 154

Cep57 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4880202 1.0 ug DNA
EUR 154

Cep57 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4880203 1.0 ug DNA
EUR 154

Cep57 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4880204 1.0 ug DNA
EUR 154

Cep57 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6671102 1.0 ug DNA
EUR 154

Cep57 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6671103 1.0 ug DNA
EUR 154

Cep57 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6671104 1.0 ug DNA
EUR 154

CEP57 Protein Vector (Human) (pPB-C-His)

PV009053 500 ng
EUR 329

CEP57 Protein Vector (Human) (pPB-N-His)

PV009054 500 ng
EUR 329

CEP57 Protein Vector (Human) (pPM-C-HA)

PV009055 500 ng
EUR 329

CEP57 Protein Vector (Human) (pPM-C-His)

PV009056 500 ng
EUR 329

CEP57 Protein Vector (Rat) (pPB-C-His)

PV259454 500 ng
EUR 603

CEP57 Protein Vector (Rat) (pPB-N-His)

PV259455 500 ng
EUR 603

CEP57 Protein Vector (Rat) (pPM-C-HA)

PV259456 500 ng
EUR 603

CEP57 Protein Vector (Rat) (pPM-C-His)

PV259457 500 ng
EUR 603

CEP57 Protein Vector (Mouse) (pPB-C-His)

PV164778 500 ng
EUR 603

CEP57 Protein Vector (Mouse) (pPB-N-His)

PV164779 500 ng
EUR 603

CEP57 Protein Vector (Mouse) (pPM-C-HA)

PV164780 500 ng
EUR 603

CEP57 Protein Vector (Mouse) (pPM-C-His)

PV164781 500 ng
EUR 603

Cep57 3'UTR Luciferase Stable Cell Line

TU202193 1.0 ml Ask for price

Cep57 3'UTR GFP Stable Cell Line

TU153740 1.0 ml Ask for price

CEP57 3'UTR Luciferase Stable Cell Line

TU004235 1.0 ml
EUR 1394

Cep57 3'UTR Luciferase Stable Cell Line

TU103740 1.0 ml Ask for price

CEP57 3'UTR GFP Stable Cell Line

TU054235 1.0 ml
EUR 1394

Cep57 3'UTR GFP Stable Cell Line

TU252193 1.0 ml Ask for price

CEP57 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV668743 1.0 ug DNA
EUR 682

CEP57 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV668747 1.0 ug DNA
EUR 682

CEP57 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV668748 1.0 ug DNA
EUR 682

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

CEP57 Rabbit Polyclonal Antibody