Cdc5L Rabbit Polyclonal Antibody

CDC5L Rabbit pAb
A5560-100ul	Abclonal	100 ul	EUR 308

CDC5L Rabbit pAb
A5560-200ul	Abclonal	200 ul	EUR 459

CDC5L Rabbit pAb
A5560-20ul	Abclonal	20 ul	EUR 183

CDC5L Rabbit pAb
A5560-50ul	Abclonal	50 ul	EUR 223

CDC5L Antibody
AF7563	Affbiotech	200ul	EUR 376
Description: CDC5L Antibody detects endogenous levels of CDC5L.

CDC5L antibody
70R-4924	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal CDC5L antibody

CDC5L Antibody
ABD13040	Lifescience Market	100 ug	EUR 438

CDC5L Antibody
ABD7400	Lifescience Market	100 ug	EUR 438

CDC5L Antibody
49288-100ul	SAB	100ul	EUR 333

CDC5L Antibody
49288-50ul	SAB	50ul	EUR 239

CDC5L antibody
10R-1324	Fitzgerald	100 ug	EUR 512
Description: Mouse monoclonal CDC5L antibody

CDC5L Antibody
32911-100ul	SAB	100ul	EUR 252

CDC5L antibody
70R-16309	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CDC5L antibody

CDC5L Antibody
DF7400	Affbiotech	200ul	EUR 304
Description: CDC5L Antibody detects endogenous levels of total CDC5L.

CDC5L Antibody
1-CSB-PA005021GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CDC5L. Recognizes CDC5L from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CDC5L Antibody
1-CSB-PA478063	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDC5L. Recognizes CDC5L from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

CDC5L Antibody
1-CSB-PA858712ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CDC5L. Recognizes CDC5L from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

CDC5L Antibody
1-CSB-PA858712ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CDC5L. Recognizes CDC5L from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CDC5L Antibody
1-CSB-PA218975	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDC5L. Recognizes CDC5L from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

CDC5L Antibody
1-CSB-PA080082	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CDC5L. Recognizes CDC5L from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

CDC5L (Phospho-Tyr232) Polyclonal Conjugated Antibody
C12928	SAB	100ul	EUR 397

CDC5L Conjugated Antibody
C49288	SAB	100ul	EUR 397

CDC5L Conjugated Antibody
C32911	SAB	100ul	EUR 397

anti- CDC5L antibody
FNab01535	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:10 - 1:100 Immunogen: CDC5 cell division cycle 5-like (S. pombe) Uniprot ID: Q99459 Gene ID: 988 Research Area: Neuroscience, Metabolism
Description: Antibody raised against CDC5L

Anti-CDC5L antibody
PAab01535	Lifescience Market	100 ug	EUR 355

Anti-CDC5L Antibody
PA2123	BosterBio	100ug/vial	EUR 294

Anti-Cdc5L antibody
STJ92180	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Cdc5L.

Anti-CDC5L antibody
STJ27506	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene shares a significant similarity with Schizosaccharomyces pombe cdc5 gene product, which is a cell cycle regulator important for G2/M transition. This protein has been demonstrated to act as a positive regulator of cell cycle G2/M progression. It was also found to be an essential component of a non-snRNA spliceosome, which contains at least five additional protein factors and is required for the second catalytic step of pre-mRNA splicing.

Cdc5l/ Rat Cdc5l ELISA Kit
ELI-50834r	Lifescience Market	96 Tests	EUR 886

CDC5L siRNA
20-abx900944	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CDC5L siRNA
20-abx911166	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CDC5L siRNA
20-abx911167	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-CDC5L
YF-PA23406	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to CDC5L

Rabbit Anti-CDC5L monoclonal antibody, clone KK102-16
CABT-L849	Creative Diagnostics	100 ul	EUR 777

Phospho-CDC5L(Tyr232) Antibody
AF7063	Affbiotech	200ul	EUR 376
Description: Phospho-CDC5L(Tyr232) Antibody detects endogenous levels of CDC5L only when phosphorylated at Tyr232.

CDC5L (Phospho-Tyr232) Antibody
12928-100ul	SAB	100ul	EUR 252

CDC5L (Phospho-Tyr232) Antibody
12928-50ul	SAB	50ul	EUR 187

CDC5L Blocking Peptide
AF7563-BP	Affbiotech	1mg	EUR 195

CDC5L Blocking Peptide
33R-5034	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CDC5L antibody, catalog no. 70R-4924

CDC5L cloning plasmid
CSB-CL858712HU-10ug	Cusabio	10ug	EUR 474
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2409 Sequence: atgcctcgaattatgatcaaggggggcgtatggaggaataccgaggatgaaattctgaaagcagcggtaatgaaatatgggaaaaatcagtggtctaggattgcctcattgctgcatagaaaatcagcaaagcagtgcaaagccagatggtatgaatggctggatccaagcatta Show more
Description: A cloning plasmid for the CDC5L gene.

CDC5L Blocking Peptide
DF7400-BP	Affbiotech	1mg	EUR 195

Anti-CDC5L (3C12)
YF-MA12357	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to CDC5L

Mouse CDC5L shRNA Plasmid
20-abx977464	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat CDC5L shRNA Plasmid
20-abx987028	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CDC5L ELISA KIT|Human
EF008554	Lifescience Market	96 Tests	EUR 689

Human CDC5L shRNA Plasmid
20-abx950703	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CDC5L Recombinant Protein (Human)
RP006532	ABM	100 ug	Ask for price

pCMV-Myc-CDC5L Plasmid
PVTB00666-2a	Lifescience Market	2 ug	EUR 356

CDC5L Recombinant Protein (Rat)
RP194162	ABM	100 ug	Ask for price

CDC5L Recombinant Protein (Mouse)
RP122894	ABM	100 ug	Ask for price

Cell Division Cycle 5 Like (CDC5L) Antibody
20-abx111507	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Cell Division Cycle 5 Like (CDC5L) Antibody
20-abx004259	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Cell Division Cycle 5 Like (CDC5L) Antibody
20-abx320245	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Cell Division Cycle 5 Like (CDC5L) Antibody
20-abx322322	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Cell Division Cycle 5 Like (CDC5L) Antibody
20-abx326676	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Cell Division Cycle 5 Like (CDC5L) Antibody
20-abx214833	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Cell Division Cycle 5 Like (CDC5L) Antibody
20-abx241486	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Cell Division Cycle 5 Like (CDC5L) Antibody
abx231535-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Phospho-CDC5L(Tyr232) Blocking Peptide
AF7063-BP	Affbiotech	1mg	EUR 195

CDC5L ORF Vector (Human) (pORF)
ORF002178	ABM	1.0 ug DNA	EUR 95

Cdc5l ORF Vector (Mouse) (pORF)
ORF040966	ABM	1.0 ug DNA	EUR 506

Cdc5l ORF Vector (Rat) (pORF)
ORF064722	ABM	1.0 ug DNA	EUR 506

Rabbit Cell division cycle 5 like protein(CDC5L) ELISA kit
E04C1523-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle 5 like protein(CDC5L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cell division cycle 5 like protein(CDC5L) ELISA kit
E04C1523-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle 5 like protein(CDC5L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cell division cycle 5 like protein(CDC5L) ELISA kit
E04C1523-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle 5 like protein(CDC5L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CDC5L sgRNA CRISPR Lentivector set (Human)
K0409401	ABM	3 x 1.0 ug	EUR 339

Cdc5l sgRNA CRISPR Lentivector set (Mouse)
K4474901	ABM	3 x 1.0 ug	EUR 339

Cdc5l sgRNA CRISPR Lentivector set (Rat)
K6998501	ABM	3 x 1.0 ug	EUR 339

CDC5L sgRNA CRISPR Lentivector (Human) (Target 1)
K0409402	ABM	1.0 ug DNA	EUR 154

CDC5L sgRNA CRISPR Lentivector (Human) (Target 2)
K0409403	ABM	1.0 ug DNA	EUR 154

CDC5L sgRNA CRISPR Lentivector (Human) (Target 3)
K0409404	ABM	1.0 ug DNA	EUR 154

Cdc5l sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4474902	ABM	1.0 ug DNA	EUR 154

Cdc5l sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4474903	ABM	1.0 ug DNA	EUR 154

Cdc5l sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4474904	ABM	1.0 ug DNA	EUR 154

Cdc5l sgRNA CRISPR Lentivector (Rat) (Target 1)
K6998502	ABM	1.0 ug DNA	EUR 154

Cdc5l sgRNA CRISPR Lentivector (Rat) (Target 2)
K6998503	ABM	1.0 ug DNA	EUR 154

Cdc5l sgRNA CRISPR Lentivector (Rat) (Target 3)
K6998504	ABM	1.0 ug DNA	EUR 154

CDC5L Protein Vector (Human) (pPB-C-His)
PV008709	ABM	500 ng	EUR 329

CDC5L Protein Vector (Human) (pPB-N-His)
PV008710	ABM	500 ng	EUR 329

CDC5L Protein Vector (Human) (pPM-C-HA)
PV008711	ABM	500 ng	EUR 329

CDC5L Protein Vector (Human) (pPM-C-His)
PV008712	ABM	500 ng	EUR 329

CDC5L Protein Vector (Rat) (pPB-C-His)
PV258886	ABM	500 ng	EUR 1166

CDC5L Protein Vector (Rat) (pPB-N-His)
PV258887	ABM	500 ng	EUR 1166

CDC5L Protein Vector (Rat) (pPM-C-HA)
PV258888	ABM	500 ng	EUR 1166

CDC5L Protein Vector (Rat) (pPM-C-His)
PV258889	ABM	500 ng	EUR 1166

CDC5L Protein Vector (Mouse) (pPB-C-His)
PV163862	ABM	500 ng	EUR 1065

CDC5L Protein Vector (Mouse) (pPB-N-His)
PV163863	ABM	500 ng	EUR 1065

CDC5L Protein Vector (Mouse) (pPM-C-HA)
PV163864	ABM	500 ng	EUR 1065

CDC5L Protein Vector (Mouse) (pPM-C-His)
PV163865	ABM	500 ng	EUR 1065

Cdc5l 3'UTR Luciferase Stable Cell Line
TU202047	ABM	1.0 ml	Ask for price

Cdc5l 3'UTR GFP Stable Cell Line
TU153574	ABM	1.0 ml	Ask for price

CDC5L 3'UTR Luciferase Stable Cell Line
TU003960	ABM	1.0 ml	EUR 2333

Cdc5l 3'UTR Luciferase Stable Cell Line
TU103574	ABM	1.0 ml	Ask for price

CDC5L 3'UTR GFP Stable Cell Line
TU053960	ABM	1.0 ml	EUR 2333

Cdc5l 3'UTR GFP Stable Cell Line
TU252047	ABM	1.0 ml	Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Cdc5L Rabbit Polyclonal Antibody