CD72 Rabbit Polyclonal Antibody

CD72 Polyclonal Antibody

ES8388-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD72 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CD72 Polyclonal Antibody

ABP57395-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD72
  • Applications tips:
Description: A polyclonal antibody for detection of CD72 from Human. This CD72 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD72

CD72 Polyclonal Antibody

ABP57395-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD72
  • Applications tips:
Description: A polyclonal antibody for detection of CD72 from Human. This CD72 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD72

CD72 Polyclonal Antibody

ABP57395-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD72
  • Applications tips:
Description: A polyclonal antibody for detection of CD72 from Human. This CD72 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD72

CD72 Rabbit pAb

A9930-100ul 100 ul
EUR 308

CD72 Rabbit pAb

A9930-200ul 200 ul
EUR 459

CD72 Rabbit pAb

A9930-20ul 20 ul
EUR 183

CD72 Rabbit pAb

A9930-50ul 50 ul
EUR 223

Human Cluster Of Differentiation 72 (CD72) ELISA Kit

DLR-CD72-Hu-48T 48T
EUR 498
  • Should the Human Cluster Of Differentiation 72 (CD72) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cluster Of Differentiation 72 (CD72) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Cluster Of Differentiation 72 (CD72) ELISA Kit

DLR-CD72-Hu-96T 96T
EUR 647
  • Should the Human Cluster Of Differentiation 72 (CD72) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cluster Of Differentiation 72 (CD72) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Cluster Of Differentiation 72 (CD72) ELISA Kit

RD-CD72-Hu-48Tests 48 Tests
EUR 500

Human Cluster Of Differentiation 72 (CD72) ELISA Kit

RD-CD72-Hu-96Tests 96 Tests
EUR 692

Human Cluster Of Differentiation 72 (CD72) ELISA Kit

RDR-CD72-Hu-48Tests 48 Tests
EUR 522

Human Cluster Of Differentiation 72 (CD72) ELISA Kit

RDR-CD72-Hu-96Tests 96 Tests
EUR 724

CD72 antibody

70R-CR046 100 ug
EUR 300
Description: Affinity purified Rabbit polyclonal CD72 antibody

CD72 antibody

70R-CR047 100 ug
EUR 300
Description: Affinity purified Rabbit polyclonal CD72 antibody

CD72 Antibody

ABD7910 100 ug
EUR 438

CD72 Antibody

45176-100ul 100ul
EUR 252

CD72 Antibody

45176-50ul 50ul
EUR 187

CD72 antibody

70R-16286 50 ul
EUR 435
Description: Rabbit polyclonal CD72 antibody

CD72 Antibody

DF7910 200ul
EUR 304
Description: CD72 Antibody detects endogenous levels of total CD72.

CD72 Antibody

1-CSB-PA004955GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CD72. Recognizes CD72 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CD72 Antibody

1-CSB-PA004955LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD72. Recognizes CD72 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

CD72 Antibody

1-CSB-PA215043
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CD72. Recognizes CD72 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

Rabbit B cell differentiation antigen CD72(CD72) ELISA kit

E04B0881-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit B cell differentiation antigen CD72(CD72) ELISA kit

E04B0881-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit B cell differentiation antigen CD72(CD72) ELISA kit

E04B0881-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

anti- CD72 antibody

FNab01498 100µg
EUR 505.25
  • Immunogen: CD72 molecule
  • Uniprot ID: P21854
  • Gene ID: 971
  • Research Area: Immunology, Cardiovascular
Description: Antibody raised against CD72

Anti-CD72 Antibody

A09292-1 100ug/vial
EUR 294

Anti-CD72 antibody

PAab01498 100 ug
EUR 355

Anti-CD72 antibody

STJ97662 200 µl
EUR 197
Description: Rabbit polyclonal to CD72.

Anti-CD72 antibody

STJ111971 100 µl
EUR 277

CD72 Protein

20-abx263522
  • EUR 829.00
  • EUR 411.00
  • EUR 537.00
  • 10 ug
  • 2 µg
  • 5 ug
  • Shipped within 5-10 working days.

CD72 siRNA

20-abx911067
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD72 siRNA

20-abx911068
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD72 Antibody, HRP conjugated

1-CSB-PA004955LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD72. Recognizes CD72 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CD72 Antibody, FITC conjugated

1-CSB-PA004955LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD72. Recognizes CD72 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CD72 Antibody, Biotin conjugated

1-CSB-PA004955LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD72. Recognizes CD72 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Human)

4-PAB261Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Glu169~Asp359)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cluster Of Differentiation 72 (CD72)

Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Mouse)

4-PAB261Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Leu143~Phe345)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 72 (CD72)

CD72 cloning plasmid

CSB-CL004955HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1080
  • Sequence: atggctgaggccatcacctatgcagatctgaggtttgtgaaggctcccctgaagaagagcatctccagccggttaggacaggacccaggggctgatgatgatggggaaatcacctacgagaatgttcaagtgcccgcagtcctaggggtgccctcaagcttggcttcttctgtac
  • Show more
Description: A cloning plasmid for the CD72 gene.

CD72 Blocking Peptide

20-abx161329
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Recombinant Human CD72

7-04738 2µg Ask for price

Recombinant Human CD72

7-04739 5µg Ask for price

Recombinant Human CD72

7-04740 10µg Ask for price

CD72 Blocking Peptide

DF7910-BP 1mg
EUR 195

Anti-CD72 (4D10)

YF-MA20291 100 ug
EUR 363
Description: Mouse monoclonal to CD72

Monoclonal CD72 Antibody, Clone: EPR3571

APR15354G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human CD72. The antibodies are raised in Rabbit and are from clone EPR3571. This antibody is applicable in WB

Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Human), APC

4-PAB261Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Glu169~Asp359)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cluster Of Differentiation 72 (CD72). This antibody is labeled with APC.

Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Human), Biotinylated

4-PAB261Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Glu169~Asp359)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cluster Of Differentiation 72 (CD72). This antibody is labeled with Biotin.

Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Human), Cy3

4-PAB261Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Glu169~Asp359)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cluster Of Differentiation 72 (CD72). This antibody is labeled with Cy3.

Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Human), FITC

4-PAB261Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Glu169~Asp359)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cluster Of Differentiation 72 (CD72). This antibody is labeled with FITC.

Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Human), HRP

4-PAB261Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Glu169~Asp359)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cluster Of Differentiation 72 (CD72). This antibody is labeled with HRP.

Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Human), PE

4-PAB261Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Glu169~Asp359)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cluster Of Differentiation 72 (CD72). This antibody is labeled with PE.

Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Mouse), APC

4-PAB261Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Leu143~Phe345)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 72 (CD72). This antibody is labeled with APC.

Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Mouse), Biotinylated

4-PAB261Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Leu143~Phe345)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 72 (CD72). This antibody is labeled with Biotin.

CD72 Rabbit Polyclonal Antibody