ATP5J2 Rabbit Polyclonal Antibody

ATP5J2 Rabbit pAb

A17055-100ul 100 ul
EUR 308

ATP5J2 Rabbit pAb

A17055-200ul 200 ul
EUR 459

ATP5J2 Rabbit pAb

A17055-20ul 20 ul
EUR 183

ATP5J2 Rabbit pAb

A17055-50ul 50 ul
EUR 223

ATP5J2 Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATP5J2 Antibody

ABD8505 100 ug
EUR 438

ATP5J2 Antibody

45316-100ul 100ul
EUR 252

ATP5J2 Antibody

45316-50ul 50ul
EUR 187

ATP5J2 Antibody

DF8505 200ul
EUR 304
Description: ATP5J2 Antibody detects endogenous levels of total ATP5J2.

ATP5J2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ATP5J2. Recognizes ATP5J2 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

ATP5J2 Conjugated Antibody

C45316 100ul
EUR 397

Anti-ATP5J2 Antibody

A12564 100ul
EUR 397
Description: Rabbit Polyclonal ATP5J2 Antibody. Validated in IHC and tested in Human.

Anti-ATP5J2 antibody

STJ91773 200 µl
EUR 197
Description: Rabbit polyclonal to ATP5J2.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ATP5J2 Blocking Peptide

DF8505-BP 1mg
EUR 195

ATP5J2 cloning plasmid

CSB-CL002370HU-10ug 10ug
EUR 189
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 285
  • Sequence: atggcgtcagttggtgagtgtccggccccagtaccagtgaaggacaagaaacttctggaggtcaaacttctggagctgccaagctggatcttgatgcgggacttcagtcctagtggcattttcggagcgtttcaaagaggttactaccggtactacaacaagtacatcaatgtgaa
  • Show more
Description: A cloning plasmid for the ATP5J2 gene.

Mouse ATP5J2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ATP5J2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat ATP5J2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ATP5J2 Recombinant Protein (Human)

RP047926 100 ug Ask for price

ATP5J2 Recombinant Protein (Mouse)

RP118013 100 ug Ask for price

Rabbit ATP synthase subunit f, mitochondrial(ATP5J2) ELISA kit

E04A1103-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP synthase subunit f, mitochondrial(ATP5J2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP synthase subunit f, mitochondrial(ATP5J2) ELISA kit

E04A1103-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP synthase subunit f, mitochondrial(ATP5J2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP synthase subunit f, mitochondrial(ATP5J2) ELISA kit

E04A1103-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP synthase subunit f, mitochondrial(ATP5J2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ATP Synthase Subunit F, Mitochondrial (ATP5J2) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATP Synthase Subunit F, Mitochondrial (ATP5J2) Antibody

abx032488-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ATP Synthase Subunit F, Mitochondrial (ATP5J2) Antibody

abx032488-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Atp5j2 ORF Vector (Mouse) (pORF)

ORF039339 1.0 ug DNA
EUR 506

ATP5J2 ORF Vector (Human) (pORF)

ORF015976 1.0 ug DNA
EUR 405

ATP5J2-PTCD1 Recombinant Protein (Human)

RP047929 100 ug Ask for price

ATP5J2 sgRNA CRISPR Lentivector set (Human)

K0149501 3 x 1.0 ug
EUR 339

Atp5j2 sgRNA CRISPR Lentivector set (Mouse)

K4625201 3 x 1.0 ug
EUR 339

ATP5J2-PTCD1 ORF Vector (Human) (pORF)

ORF015977 1.0 ug DNA Ask for price

ATP5J2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0149502 1.0 ug DNA
EUR 154

ATP5J2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0149503 1.0 ug DNA
EUR 154

ATP5J2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0149504 1.0 ug DNA
EUR 154

ATP5J2-PTCD1 sgRNA CRISPR Lentivector set (Human)

K2749001 3 x 1.0 ug
EUR 339

Atp5j2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4625202 1.0 ug DNA
EUR 154

Atp5j2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4625203 1.0 ug DNA
EUR 154

Atp5j2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4625204 1.0 ug DNA
EUR 154

ATP5J2 Protein Vector (Human) (pPB-C-His)

PV063901 500 ng
EUR 552

ATP5J2 Protein Vector (Human) (pPB-N-His)

PV063902 500 ng
EUR 552

ATP5J2 Protein Vector (Human) (pPM-C-HA)

PV063903 500 ng
EUR 552

ATP5J2 Protein Vector (Human) (pPM-C-His)

PV063904 500 ng
EUR 552

ATP5J2 Protein Vector (Human) (pPB-His-MBP)

PV325258 500 ng
EUR 552

ATP5J2 Protein Vector (Human) (pPB-His-GST)

PV325259 500 ng
EUR 552

ATP5J2 Protein Vector (Mouse) (pPB-C-His)

PV157354 500 ng
EUR 603

ATP5J2 Protein Vector (Mouse) (pPB-N-His)

PV157355 500 ng
EUR 603

ATP5J2 Protein Vector (Mouse) (pPM-C-HA)

PV157356 500 ng
EUR 603

ATP5J2 Protein Vector (Mouse) (pPM-C-His)

PV157357 500 ng
EUR 603

Atp5j2 3'UTR Luciferase Stable Cell Line

TU201089 1.0 ml Ask for price

Atp5j2 3'UTR GFP Stable Cell Line

TU152332 1.0 ml Ask for price

ATP5J2 3'UTR Luciferase Stable Cell Line

TU001421 1.0 ml
EUR 1394

Atp5j2 3'UTR Luciferase Stable Cell Line

TU102332 1.0 ml Ask for price

ATP5J2 3'UTR GFP Stable Cell Line

TU051421 1.0 ml
EUR 1394

Atp5j2 3'UTR GFP Stable Cell Line

TU251089 1.0 ml Ask for price

ATP5J2-PTCD1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2749002 1.0 ug DNA
EUR 154

ATP5J2-PTCD1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2749003 1.0 ug DNA
EUR 154

ATP5J2-PTCD1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2749004 1.0 ug DNA
EUR 154

ATP5J2-PTCD1 Protein Vector (Human) (pPB-C-His)

PV063905 500 ng Ask for price

ATP5J2-PTCD1 Protein Vector (Human) (pPB-N-His)

PV063906 500 ng Ask for price

ATP5J2-PTCD1 Protein Vector (Human) (pPM-C-HA)

PV063907 500 ng Ask for price

ATP5J2-PTCD1 Protein Vector (Human) (pPM-C-His)

PV063908 500 ng Ask for price

ATP5J2-PTCD1 Protein Vector (Human) (pPB-His-MBP)

PV325262 500 ng Ask for price

ATP5J2-PTCD1 Protein Vector (Human) (pPB-His-GST)

PV325263 500 ng Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

ATP5J2 Rabbit Polyclonal Antibody