Atg9a Rabbit Polyclonal Antibody

Atg9a Polyclonal Antibody
ABP57483-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide of Atg9a
  • Applications tips:
Description: A polyclonal antibody for detection of Atg9a from Human, Mouse, Rat. This Atg9a antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of Atg9a

Atg9a Polyclonal Antibody
ES8476-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Atg9a from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Atg9a Polyclonal Antibody
ES8476-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Atg9a from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ATG9A Rabbit pAb
A7994-100ul 100 ul
EUR 308

ATG9A Rabbit pAb
A7994-200ul 200 ul
EUR 459

ATG9A Rabbit pAb
A7994-20ul 20 ul
EUR 183

ATG9A Rabbit pAb
A7994-50ul 50 ul
EUR 223

ATG9A Rabbit pAb
A5571-100ul 100 ul
EUR 308

ATG9A Rabbit pAb
A5571-200ul 200 ul
EUR 459

ATG9A Rabbit pAb
A5571-20ul 20 ul
EUR 183

ATG9A Rabbit pAb
A5571-50ul 50 ul
EUR 223

Polyclonal ATG9A Antibody (Center)
APG02067G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG9A (Center). This antibody is tested and proven to work in the following applications:

Anti-ATG9A Rabbit Monoclonal Antibody
M03757 100ug/vial
EUR 397
Description: Rabbit Monoclonal ATG9A Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

ATG9A Antibody
25202-100ul 100ul
EUR 390

ATG9A Antibody
36225-100ul 100ul
EUR 252

ATG9A Antibody
48988-100ul 100ul
EUR 333

ATG9A Antibody
48988-50ul 50ul
EUR 239

ATG9A Antibody
1-CSB-PA868793
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ATG9A. Recognizes ATG9A from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

ATG9A Antibody
1-CSB-PA773782ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ATG9A. Recognizes ATG9A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ATG9A Antibody
DF2695 200ul
EUR 304
Description: ATG9A antibody detects endogenous levels of total ATG9A.

ATG9A Antibody
DF8034 200ul
EUR 304
Description: ATG9A Antibody detects endogenous levels of total ATG9A.

ATG9A Antibody
1-CSB-PA554014
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ATG9A. Recognizes ATG9A from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

Atg9a antibody
70R-9633 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Atg9a antibody

ATG9A antibody
70R-6415 50 ug
EUR 467
Description: Rabbit polyclonal ATG9A antibody

ATG9A Antibody
ABD2695 100 ug
EUR 438

ATG9A Antibody
ABD8034 100 ug
EUR 438

ATG9A Antibody
ABD8346 100 ug
EUR 438

Polyclonal ATG9A Antibody (C-Terminus)
APG02066G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG9A (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal ATG9A Antibody (C-term)
APR07027G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG9A (C-term). This antibody is tested and proven to work in the following applications:

ATG9A Conjugated Antibody
C48988 100ul
EUR 397

ATG9A Conjugated Antibody
C36225 100ul
EUR 397

Anti-ATG9A antibody
STJ110301 100 µl
EUR 277

Anti-ATG9A antibody
STJ117815 100 µl
EUR 277

Anti-ATG9A antibody
STJ13100025 150 µl
EUR 427

Anti-Atg9a antibody
STJ98589 200 µl
EUR 197
Description: Rabbit polyclonal to Atg9a.

Atg9a/ Rat Atg9a ELISA Kit
ELI-49603r 96 Tests
EUR 886

ATG9A siRNA
20-abx900504
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ATG9A siRNA
20-abx908472
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ATG9A siRNA
20-abx908473
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Rabbit Anti-ATG9A monoclonal antibody, clone TD78-16
CABT-L711 100 ul
EUR 777

ATG9A recombinant monoclonal antibody
A5123 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human ATG9A for WB,ELISA

Atg9a Blocking Peptide
33R-1246 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LARGE antibody, catalog no. 70R-6856

ATG9A Blocking Peptide
33R-9437 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ATG9A antibody, catalog no. 70R-6415

ATG9A Blocking Peptide
DF2695-BP 1mg
EUR 195

ATG9A Blocking Peptide
DF8034-BP 1mg
EUR 195

ATG9A cloning plasmid
CSB-CL773782HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1566
  • Sequence: atggtgaaccacagtcttcaccctactgaacccgtcaaggtcactctgccagacgcctttttgcctgctcaagtctgtagtgccaggattcaggaaaatggctcccttatcaccatcctggtcattgctggtgtcttctggatccaccggcttatcaagttcatctataacattt
  • Show more
Description: A cloning plasmid for the ATG9A gene.

ATG9A cloning plasmid
CSB-CL773782HU2-10ug 10ug
EUR 553
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1587
  • Sequence: atggcgcagtttgacactgaataccagcgcctagaggcctcctatagtgattcacccccaggggaggaggacctgttggtgcacgtcgccgaggggagcaagtcaccttggcaccatattgaaaaccttgacctcttcttctctcgagtttataatctgcaccagaagaatggct
  • Show more
Description: A cloning plasmid for the ATG9A gene.

Autophagy Related 9A (ATG9A) Antibody
20-abx007110
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody
abx030060-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody
abx030060-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody
abx030061-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody
abx030061-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody
20-abx242486
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody
20-abx242504
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody
abx412192-01mg 0.1 mg
EUR 537
  • Shipped within 1 week.

Autophagy Related 9A (ATG9A) Antibody
20-abx320321
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody
20-abx225051
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rabbit Autophagy related protein 9A(ATG9A) ELISA kit
E04A1751-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Autophagy related protein 9A(ATG9A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Autophagy related protein 9A(ATG9A) ELISA kit
E04A1751-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Autophagy related protein 9A(ATG9A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Autophagy related protein 9A(ATG9A) ELISA kit
E04A1751-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Autophagy related protein 9A(ATG9A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ATG9A shRNA Plasmid
20-abx990528
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ATG9A shRNA Plasmid
20-abx982782
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ATG9A shRNA Plasmid
20-abx962285
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-Flag-ATG9A Plasmid
PVTB01039-2a 2 ug
EUR 356

Atg9a ORF Vector (Rat) (pORF)
ORF063780 1.0 ug DNA
EUR 506

ATG9A ORF Vector (Human) (pORF)
ORF000742 1.0 ug DNA
EUR 95

ATG9A ORF Vector (Human) (pORF)
ORF000743 1.0 ug DNA
EUR 95

Atg9a ORF Vector (Mouse) (pORF)
ORF039266 1.0 ug DNA
EUR 506

pECMV-Atg9a-m-FLAG Plasmid
PVT15103 2 ug
EUR 325

Atg9a sgRNA CRISPR Lentivector set (Rat)
K7300301 3 x 1.0 ug
EUR 339

Atg9a sgRNA CRISPR Lentivector set (Mouse)
K4301701 3 x 1.0 ug
EUR 339

ATG9A sgRNA CRISPR Lentivector set (Human)
K0142601 3 x 1.0 ug
EUR 339

Atg9a sgRNA CRISPR Lentivector (Rat) (Target 1)
K7300302 1.0 ug DNA
EUR 154

Atg9a sgRNA CRISPR Lentivector (Rat) (Target 2)
K7300303 1.0 ug DNA
EUR 154

Atg9a sgRNA CRISPR Lentivector (Rat) (Target 3)
K7300304 1.0 ug DNA
EUR 154

Atg9a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4301702 1.0 ug DNA
EUR 154

Atg9a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4301703 1.0 ug DNA
EUR 154

Atg9a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4301704 1.0 ug DNA
EUR 154

ATG9A sgRNA CRISPR Lentivector (Human) (Target 1)
K0142602 1.0 ug DNA
EUR 154

ATG9A sgRNA CRISPR Lentivector (Human) (Target 2)
K0142603 1.0 ug DNA
EUR 154

ATG9A sgRNA CRISPR Lentivector (Human) (Target 3)
K0142604 1.0 ug DNA
EUR 154

ATG9A Protein Vector (Mouse) (pPB-C-His)
PV157062 500 ng
EUR 1065

ATG9A Protein Vector (Mouse) (pPB-N-His)
PV157063 500 ng
EUR 1065

ATG9A Protein Vector (Mouse) (pPM-C-HA)
PV157064 500 ng
EUR 1065

ATG9A Protein Vector (Mouse) (pPM-C-His)
PV157065 500 ng
EUR 1065

ATG9A Protein Vector (Rat) (pPB-C-His)
PV255118 500 ng
EUR 1191

ATG9A Protein Vector (Rat) (pPB-N-His)
PV255119 500 ng
EUR 1191

ATG9A Protein Vector (Rat) (pPM-C-HA)
PV255120 500 ng
EUR 1191

ATG9A Protein Vector (Rat) (pPM-C-His)
PV255121 500 ng
EUR 1191

ATG9A Protein Vector (Human) (pPB-His-MBP)
PV324806 500 ng
EUR 329

ATG9A Protein Vector (Human) (pPB-His-GST)
PV324807 500 ng
EUR 329

ATG9A Protein Vector (Human) (pPB-His-MBP)
PV324810 500 ng
EUR 329

ATG9A Protein Vector (Human) (pPB-His-GST)
PV324811 500 ng
EUR 329

ATG9A Protein Vector (Human) (pPB-C-His)
PV002965 500 ng
EUR 329

ATG9A Protein Vector (Human) (pPB-N-His)
PV002966 500 ng
EUR 329

ATG9A Protein Vector (Human) (pPM-C-HA)
PV002967 500 ng
EUR 329

ATG9A Protein Vector (Human) (pPM-C-His)
PV002968 500 ng
EUR 329

ATG9A Protein Vector (Human) (pPB-C-His)
PV002969 500 ng
EUR 329

ATG9A Protein Vector (Human) (pPB-N-His)
PV002970 500 ng
EUR 329

ATG9A Protein Vector (Human) (pPM-C-HA)
PV002971 500 ng
EUR 329

ATG9A Protein Vector (Human) (pPM-C-His)
PV002972 500 ng
EUR 329

pGEX-4T-1-ATG9A(670-839aa) Plasmid
PVTB01039-1a 2 ug
EUR 356

Atg9a 3'UTR GFP Stable Cell Line
TU152276 1.0 ml Ask for price

Atg9a 3'UTR Luciferase Stable Cell Line
TU102276 1.0 ml Ask for price

Atg9a 3'UTR Luciferase Stable Cell Line
TU201033 1.0 ml Ask for price

Atg9a 3'UTR GFP Stable Cell Line
TU251033 1.0 ml Ask for price

ATG9A 3'UTR GFP Stable Cell Line
TU051344 1.0 ml
EUR 2333

ATG9A 3'UTR Luciferase Stable Cell Line
TU001344 1.0 ml
EUR 2333

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

Atg9a Rabbit Polyclonal Antibody