ACSS1 Rabbit Polyclonal Antibody

ACSS1 Polyclonal Antibody

ABP50589-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ACSS1 at AA range: 580-660
  • Applications tips:
Description: A polyclonal antibody for detection of ACSS1 from Human, Mouse. This ACSS1 antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ACSS1 at AA range: 580-660

ACSS1 Polyclonal Antibody

ABP50589-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ACSS1 at AA range: 580-660
  • Applications tips:
Description: A polyclonal antibody for detection of ACSS1 from Human, Mouse. This ACSS1 antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ACSS1 at AA range: 580-660

ACSS1 Polyclonal Antibody

ABP50589-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ACSS1 at AA range: 580-660
  • Applications tips:
Description: A polyclonal antibody for detection of ACSS1 from Human, Mouse. This ACSS1 antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ACSS1 at AA range: 580-660

ACSS1 Polyclonal Antibody

ABP57535-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic peptide from human protein at AA range: 620-689
  • Applications tips:
Description: A polyclonal antibody for detection of ACSS1 from Human, Mouse, Rat. This ACSS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 620-689

ACSS1 Polyclonal Antibody

ABP57535-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic peptide from human protein at AA range: 620-689
  • Applications tips:
Description: A polyclonal antibody for detection of ACSS1 from Human, Mouse, Rat. This ACSS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 620-689

ACSS1 Polyclonal Antibody

ABP57535-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 620-689
  • Applications tips:
Description: A polyclonal antibody for detection of ACSS1 from Human, Mouse, Rat. This ACSS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 620-689

ACSS1 Polyclonal Antibody

ES8528-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ACSS1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ACSS1 Polyclonal Antibody

ES8528-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ACSS1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ACSS1 Polyclonal Antibody

ES1588-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ACSS1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

ACSS1 Polyclonal Antibody

ES1588-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ACSS1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

ACSS1 Rabbit pAb

A15007-100ul 100 ul
EUR 308

ACSS1 Rabbit pAb

A15007-200ul 200 ul
EUR 459

ACSS1 Rabbit pAb

A15007-20ul 20 ul
EUR 183

ACSS1 Rabbit pAb

A15007-50ul 50 ul
EUR 223

ACSS1 Polyclonal Conjugated Antibody

C28801 100ul
EUR 397

ACSS1 antibody

70R-15558 50 ul
EUR 435
Description: Rabbit polyclonal ACSS1 antibody

ACSS1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ACSS1. Recognizes ACSS1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

ACSS1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ACSS1. Recognizes ACSS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ACSS1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against ACSS1. Recognizes ACSS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000

ACSS1 Antibody

DF3727 200ul
EUR 304
Description: ACSS1 Antibody detects endogenous levels of total ACSS1.

ACSS1 Antibody

ABD13007 100 ug
EUR 438

ACSS1 Antibody

ABD3727 100 ug
EUR 438

ACSS1 (Acetyl-K642) Polyclonal Antibody

ABP57695-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ACSS1 (Acetyl-K642) protein at amino acid sequence of K642
  • Applications tips:
Description: A polyclonal antibody for detection of ACSS1 Acetyl-K642) from Human, Mouse, Rat. This ACSS1 Acetyl-K642) antibody is for WB, ICC. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACSS1 (Acetyl-K642) protein at amino acid sequence of K642

ACSS1 (Acetyl-K642) Polyclonal Antibody

ABP57695-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ACSS1 (Acetyl-K642) protein at amino acid sequence of K642
  • Applications tips:
Description: A polyclonal antibody for detection of ACSS1 Acetyl-K642) from Human, Mouse, Rat. This ACSS1 Acetyl-K642) antibody is for WB, ICC. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACSS1 (Acetyl-K642) protein at amino acid sequence of K642

ACSS1 (Acetyl-K642) Polyclonal Antibody

ABP57695-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ACSS1 (Acetyl-K642) protein at amino acid sequence of K642
  • Applications tips:
Description: A polyclonal antibody for detection of ACSS1 Acetyl-K642) from Human, Mouse, Rat. This ACSS1 Acetyl-K642) antibody is for WB, ICC. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACSS1 (Acetyl-K642) protein at amino acid sequence of K642

ACSS1 (Acetyl-K642) Polyclonal Antibody

HW182-100ul 100ul
EUR 252

ACSS1 (Acetyl-K642) Polyclonal Antibody

HW182-50ul 50ul
EUR 187

ACSS1 (Acetyl-K642) Polyclonal Antibody

ES8818-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ACSS1 (Acetyl-K642) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ACSS1 (Acetyl-K642) Polyclonal Antibody

ES8818-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ACSS1 (Acetyl-K642) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-ACSS1 Antibody

A07972 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ACSS1 Antibody (ACSS1) detection.tested for WB in Human, Mouse.

anti- ACSS1 antibody

FNab00113 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:10000
  • IP: 1:200-1:2000
  • Immunogen: acyl-CoA synthetase short-chain family member 1
  • Uniprot ID: Q9NUB1
  • Gene ID: 84532
  • Research Area: Metabolism
Description: Antibody raised against ACSS1

Anti-ACSS1 antibody

PAab00113 100 ug
EUR 386

Anti-ACSS1 antibody

STJ117203 100 µl
EUR 277
Description: This gene encodes a mitochondrial acetyl-CoA synthetase enzyme. A similar protein in mice plays an important role in the tricarboxylic acid cycle by catalyzing the conversion of acetate to acetyl CoA. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-ACSS1 antibody

STJ91458 200 µl
EUR 197
Description: Rabbit polyclonal to ACSS1.

Anti-ACSS1 antibody

STJ98641 200 µl
EUR 197
Description: Rabbit polyclonal to ACSS1.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA21425 50 ug
EUR 363
Description: Mouse polyclonal to ACSS1

Acetyl-ACSS1 (K642) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Acetyl-ACSS1 (K642). Recognizes Acetyl-ACSS1 (K642) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

ACSS1 Blocking Peptide

DF3727-BP 1mg
EUR 195

ACSS1 Blocking Peptide

  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

ACSS1 cloning plasmid

CSB-CL882105HU-10ug 10ug
EUR 689
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2070
  • Sequence: atggcggcgcgcaccctgggccgcggcgtcgggaggctgctgggcagcctgcgagggctctcggggcagcccgcgcggccgccgtgcggggtgagcgcgccgcgcagggcggcctcgggaccctcgggcagcgctcccgcagttgcagcagcagcagcacagccaggctcgtatc
  • Show more
Description: A cloning plasmid for the ACSS1 gene.

Anti-ACSS1 (Acetyl K642) antibody

STJ98836 200 µl
EUR 197
Description: Rabbit polyclonal to E2F-1 (Acetyl-K125).


EF007590 96 Tests
EUR 689

Mouse ACSS1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ACSS1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-34917h 96 Tests
EUR 824

Mouse Acss1 ELISA KIT

ELI-49859m 96 Tests
EUR 865

ACSS1 Rabbit Polyclonal Antibody